![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: ZNF486 |
Gene summary for ZNF486 |
![]() |
Gene information | Species | Human | Gene symbol | ZNF486 | Gene ID | 90649 |
Gene name | zinc finger protein 486 | |
Gene Alias | KRBO2 | |
Cytomap | 19p12 | |
Gene Type | protein-coding | GO ID | GO:0006139 | UniProtAcc | Q4G180 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
90649 | ZNF486 | HCC1 | Human | Liver | HCC | 2.13e-11 | 1.47e+00 | 0.5336 |
90649 | ZNF486 | HCC2 | Human | Liver | HCC | 1.78e-17 | 2.10e+00 | 0.5341 |
90649 | ZNF486 | HCC5 | Human | Liver | HCC | 2.44e-08 | 8.15e-01 | 0.4932 |
90649 | ZNF486 | S016 | Human | Liver | HCC | 2.49e-03 | 7.66e-02 | 0.2243 |
90649 | ZNF486 | male-WTA | Human | Thyroid | PTC | 1.95e-40 | 5.19e-01 | 0.1037 |
90649 | ZNF486 | PTC01 | Human | Thyroid | PTC | 2.07e-11 | 2.56e-01 | 0.1899 |
90649 | ZNF486 | PTC03 | Human | Thyroid | PTC | 1.59e-03 | 4.76e-01 | 0.1784 |
90649 | ZNF486 | PTC04 | Human | Thyroid | PTC | 4.40e-29 | 8.54e-01 | 0.1927 |
90649 | ZNF486 | PTC05 | Human | Thyroid | PTC | 1.32e-31 | 1.32e+00 | 0.2065 |
90649 | ZNF486 | PTC06 | Human | Thyroid | PTC | 3.35e-44 | 1.22e+00 | 0.2057 |
90649 | ZNF486 | PTC07 | Human | Thyroid | PTC | 1.32e-81 | 1.51e+00 | 0.2044 |
90649 | ZNF486 | ATC12 | Human | Thyroid | ATC | 7.15e-03 | 7.88e-04 | 0.34 |
90649 | ZNF486 | ATC13 | Human | Thyroid | ATC | 1.70e-07 | 1.36e-01 | 0.34 |
90649 | ZNF486 | ATC4 | Human | Thyroid | ATC | 4.55e-04 | 2.01e-02 | 0.34 |
90649 | ZNF486 | ATC5 | Human | Thyroid | ATC | 1.43e-12 | 1.61e-01 | 0.34 |
Page: 1 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ZNF486 | SNV | Missense_Mutation | c.1114N>G | p.His372Asp | p.H372D | Q96H40 | protein_coding | deleterious(0.01) | probably_damaging(0.989) | TCGA-A2-A0CT-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | cytoxan | SD | |
ZNF486 | SNV | Missense_Mutation | c.898N>A | p.Asp300Asn | p.D300N | Q96H40 | protein_coding | deleterious(0) | benign(0.21) | TCGA-A8-A081-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
ZNF486 | SNV | Missense_Mutation | c.438N>C | p.Leu146Phe | p.L146F | Q96H40 | protein_coding | tolerated(0.1) | benign(0.071) | TCGA-D8-A27G-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
ZNF486 | SNV | Missense_Mutation | novel | c.198G>C | p.Glu66Asp | p.E66D | Q96H40 | protein_coding | deleterious(0.01) | probably_damaging(0.997) | TCGA-S3-AA10-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | cytoxan | CR |
ZNF486 | deletion | Frame_Shift_Del | c.1357_1358delNN | p.Lys453GlufsTer51 | p.K453Efs*51 | Q96H40 | protein_coding | TCGA-A2-A0YF-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unspecific | Arimidex | SD | |||
ZNF486 | insertion | Nonsense_Mutation | novel | c.437_438insCTCCTAAA | p.Leu146PhefsTer3 | p.L146Ffs*3 | Q96H40 | protein_coding | TCGA-AN-A046-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | ||
ZNF486 | insertion | Frame_Shift_Ins | novel | c.438_439insTGCTGGGTTTACAGGCATCAGCCACTGC | p.Thr147CysfsTer21 | p.T147Cfs*21 | Q96H40 | protein_coding | TCGA-AN-A046-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | ||
ZNF486 | deletion | Frame_Shift_Del | c.644_696delGTGGCAAAGCCTTCAACCGGTCCTCACACCTTACTACACATAAGATAACTCAT | p.Cys215TyrfsTer2 | p.C215Yfs*2 | Q96H40 | protein_coding | TCGA-D8-A1JK-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |||
ZNF486 | deletion | Frame_Shift_Del | c.814_829delGGCAAAGCCTTTATGT | p.Gly272ThrfsTer10 | p.G272Tfs*10 | Q96H40 | protein_coding | TCGA-D8-A1JK-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |||
ZNF486 | SNV | Missense_Mutation | c.76G>A | p.Glu26Lys | p.E26K | Q96H40 | protein_coding | deleterious(0) | probably_damaging(1) | TCGA-C5-A7CH-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unspecific | SD |
Page: 1 2 3 4 5 6 7 8 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |