Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact
Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: TGIF1

Gene summary for TGIF1

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

TGIF1

Gene ID

7050

Gene nameTGFB induced factor homeobox 1
Gene AliasHPE4
Cytomap18p11.31
Gene Typeprotein-coding
GO ID

GO:0000122

UniProtAcc

Q15583


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
7050TGIF1HTA11_3410_2000001011HumanColorectumAD4.68e-042.82e-010.0155
7050TGIF1HTA11_1938_2000001011HumanColorectumAD2.66e-127.75e-01-0.0811
7050TGIF1HTA11_78_2000001011HumanColorectumAD1.60e-044.91e-01-0.1088
7050TGIF1HTA11_347_2000001011HumanColorectumAD5.33e-044.07e-01-0.1954
7050TGIF1HTA11_696_2000001011HumanColorectumAD2.11e-043.02e-01-0.1464
7050TGIF1HTA11_866_2000001011HumanColorectumAD3.34e-032.77e-01-0.1001
7050TGIF1HTA11_1391_2000001011HumanColorectumAD8.76e-116.85e-01-0.059
7050TGIF1HTA11_866_3004761011HumanColorectumAD2.62e-168.27e-010.096
7050TGIF1HTA11_7663_2000001011HumanColorectumSER6.62e-069.86e-010.0131
7050TGIF1HTA11_10623_2000001011HumanColorectumAD2.17e-065.67e-01-0.0177
7050TGIF1HTA11_7696_3000711011HumanColorectumAD5.13e-196.58e-010.0674
7050TGIF1HTA11_7469_2000001011HumanColorectumAD1.50e-026.99e-01-0.0124
7050TGIF1HTA11_6818_2000001021HumanColorectumAD2.09e-086.13e-010.0588
7050TGIF1HTA11_99999970781_79442HumanColorectumMSS1.69e-278.83e-010.294
7050TGIF1HTA11_99999965104_69814HumanColorectumMSS7.95e-127.30e-010.281
7050TGIF1HTA11_99999971662_82457HumanColorectumMSS2.35e-064.56e-010.3859
7050TGIF1HTA11_99999973899_84307HumanColorectumMSS6.00e-066.53e-010.2585
7050TGIF1A002-C-116HumanColorectumFAP4.74e-02-5.91e-02-0.0452
7050TGIF1LZE4THumanEsophagusESCC4.60e-034.31e-020.0811
7050TGIF1LZE7THumanEsophagusESCC4.17e-061.18e+000.0667
Page: 1 2 3 4 5 6 7 8 9 10 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
Colorectum (GSE201348)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.FAP: Familial adenomatous polyposis
CRC: Colorectal cancer
Colorectum (HTA11)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AD: Adenomas
SER: Sessile serrated lesions
MSI-H: Microsatellite-high colorectal cancer
MSS: Microsatellite stable colorectal cancer
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
LiverThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.HCC: Hepatocellular carcinoma
NAFLD: Non-alcoholic fatty liver disease
LungThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AAH: Atypical adenomatous hyperplasia
AIS: Adenocarcinoma in situ
IAC: Invasive lung adenocarcinoma
MIA: Minimally invasive adenocarcinoma
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
ProstateThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.BPH: Benign Prostatic Hyperplasia
SkinThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AK: Actinic keratosis
cSCC: Cutaneous squamous cell carcinoma
SCCIS:squamous cell carcinoma in situ
ThyroidThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ATC: Anaplastic thyroid cancer
HT: Hashimoto's thyroiditis
PTC: Papillary thyroid cancer
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:0009410ColorectumADresponse to xenobiotic stimulus128/3918462/187232.69e-043.31e-03128
GO:00094101ColorectumMSSresponse to xenobiotic stimulus110/3467462/187232.36e-031.92e-02110
GO:00094102ColorectumFAPresponse to xenobiotic stimulus87/2622462/187232.15e-031.77e-0287
GO:000941020EsophagusESCCresponse to xenobiotic stimulus253/8552462/187234.55e-053.58e-04253
GO:000941012LiverCirrhoticresponse to xenobiotic stimulus165/4634462/187236.82e-082.09e-06165
GO:000941022LiverHCCresponse to xenobiotic stimulus248/7958462/187236.47e-071.02e-05248
GO:000941018Oral cavityOSCCresponse to xenobiotic stimulus222/7305462/187234.00e-053.48e-04222
GO:000941019Oral cavityLPresponse to xenobiotic stimulus141/4623462/187232.33e-031.68e-02141
GO:000941016ProstateBPHresponse to xenobiotic stimulus106/3107462/187232.24e-041.79e-03106
GO:000941017ProstateTumorresponse to xenobiotic stimulus110/3246462/187232.13e-041.84e-03110
GO:000941025SkinAKresponse to xenobiotic stimulus67/1910462/187231.98e-031.34e-0267
GO:0009410110SkincSCCresponse to xenobiotic stimulus151/4864462/187236.76e-044.82e-03151
GO:0009410111ThyroidPTCresponse to xenobiotic stimulus171/5968462/187231.00e-024.07e-02171
GO:000941027ThyroidATCresponse to xenobiotic stimulus184/6293462/187232.70e-031.23e-02184
Page: 1 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
hsa043507EsophagusESCCTGF-beta signaling pathway69/4205108/84651.92e-035.54e-032.84e-0369
hsa0435014EsophagusESCCTGF-beta signaling pathway69/4205108/84651.92e-035.54e-032.84e-0369
hsa043506Oral cavityOSCCTGF-beta signaling pathway60/3704108/84658.66e-031.97e-021.00e-0260
hsa0435013Oral cavityOSCCTGF-beta signaling pathway60/3704108/84658.66e-031.97e-021.00e-0260
hsa043505ProstateBPHTGF-beta signaling pathway35/1718108/84651.98e-037.92e-034.90e-0335
hsa0435012ProstateBPHTGF-beta signaling pathway35/1718108/84651.98e-037.92e-034.90e-0335
hsa0435021ProstateTumorTGF-beta signaling pathway39/1791108/84652.33e-041.35e-038.39e-0439
hsa0435031ProstateTumorTGF-beta signaling pathway39/1791108/84652.33e-041.35e-038.39e-0439
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
TGIF1IMGOBColorectumCRCIFT81,CDCA2,ESS2, etc.0.00e+00The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
TGIF1EEColorectumCRCIFT81,CDCA2,ESS2, etc.0.00e+00The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
TGIF1CTColorectumCRCIFT81,CDCA2,ESS2, etc.0.00e+00The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
TGIF1SSCColorectumCRCIFT81,CDCA2,ESS2, etc.2.22e-16The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
TGIF1CTColorectumFAPIFT81,CDCA2,ESS2, etc.4.02e-03The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
TGIF1EEColorectumFAPIFT81,CDCA2,ESS2, etc.1.30e-03The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
TGIF1SSCColorectumFAPIFT81,CDCA2,ESS2, etc.0.00e+00The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
TGIF1ENDLiverCirrhoticAPOD,FABP5,RP11-511P7.5, etc.1.96e-03The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
TGIF1ENDLiverHealthyAPOD,FABP5,RP11-511P7.5, etc.1.44e-02The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
TGIF1MVALiverNAFLDAPOD,FABP5,RP11-511P7.5, etc.6.00e-02The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 2 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
TGIF1SNVMissense_Mutationnovelc.683N>Tp.Arg228Ilep.R228IQ15583protein_codingdeleterious(0)possibly_damaging(0.773)TCGA-AN-A046-01Breastbreast invasive carcinomaFemale>=65I/IIUnknownUnknownSD
TGIF1insertionNonsense_Mutationnovelc.945_946insGGTCAGGAAACTTGTTGAGTTAAATTp.Ser316GlyfsTer6p.S316Gfs*6Q15583protein_codingTCGA-A2-A0CT-01Breastbreast invasive carcinomaFemale>=65I/IIChemotherapycytoxanSD
TGIF1deletionFrame_Shift_Delc.548_593delTGTATGAGCACCGTTACAATGCCTATCCTTCAGAGCAAGAAAAAGCp.Leu183ArgfsTer30p.L183Rfs*30Q15583protein_codingTCGA-BH-A0AZ-01Breastbreast invasive carcinomaFemale<65III/IVChemotherapydoxorubicinCR
TGIF1SNVMissense_Mutationc.433N>Cp.Glu145Glnp.E145QQ15583protein_codingdeleterious_low_confidence(0.03)benign(0.052)TCGA-DR-A0ZM-01Cervixcervical & endocervical cancerFemale<65III/IVUnspecificCisplatinSD
TGIF1SNVMissense_Mutationc.410T>Gp.Val137Glyp.V137GQ15583protein_codingtolerated_low_confidence(0.08)benign(0.138)TCGA-MU-A51Y-01Cervixcervical & endocervical cancerFemale<65I/IIUnknownUnknownSD
TGIF1SNVMissense_Mutationc.634N>Gp.Cys212Glyp.C212GQ15583protein_codingdeleterious(0)probably_damaging(0.928)TCGA-G4-6298-01Colorectumcolon adenocarcinomaMale>=65III/IVChemotherapyirinotecanPD
TGIF1SNVMissense_Mutationc.535N>Ap.Leu179Ilep.L179IQ15583protein_codingdeleterious(0)probably_damaging(0.988)TCGA-EI-6917-01Colorectumrectum adenocarcinomaMale<65III/IVChemotherapy5fluorouracil+oxaciplatina+l-folinianSD
TGIF1SNVMissense_Mutationnovelc.124N>Cp.Phe42Leup.F42LQ15583protein_codingtolerated_low_confidence(0.16)benign(0)TCGA-F5-6814-01Colorectumrectum adenocarcinomaMale<65I/IIUnknownUnknownSD
TGIF1insertionFrame_Shift_Insnovelc.864_865insCCGTp.Ser291ValfsTer61p.S291Vfs*61Q15583protein_codingTCGA-A6-2684-01Colorectumcolon adenocarcinomaFemale>=65I/IIUnknownUnknownPD
TGIF1insertionFrame_Shift_Insnovelc.449_450insGp.Asp151GlyfsTer35p.D151Gfs*35Q15583protein_codingTCGA-A6-3808-01Colorectumcolon adenocarcinomaMale>=65I/IIUnknownUnknownSD
Page: 1 2 3 4 5 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1