Tissue | Expression Dynamics | Abbreviation |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/TBRG4_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Liver/TBRG4_pca_on_diff_genes.png) | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/TBRG4_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/TBRG4_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/TBRG4_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:1903311110 | Esophagus | ESCC | regulation of mRNA metabolic process | 210/8552 | 288/18723 | 3.25e-21 | 5.56e-19 | 210 |
GO:0006401110 | Esophagus | ESCC | RNA catabolic process | 204/8552 | 278/18723 | 3.39e-21 | 5.66e-19 | 204 |
GO:014005313 | Esophagus | ESCC | mitochondrial gene expression | 93/8552 | 108/18723 | 1.96e-18 | 2.03e-16 | 93 |
GO:0034655110 | Esophagus | ESCC | nucleobase-containing compound catabolic process | 272/8552 | 407/18723 | 2.92e-18 | 2.90e-16 | 272 |
GO:0006402110 | Esophagus | ESCC | mRNA catabolic process | 170/8552 | 232/18723 | 8.70e-18 | 8.00e-16 | 170 |
GO:004670018 | Esophagus | ESCC | heterocycle catabolic process | 286/8552 | 445/18723 | 1.12e-15 | 7.47e-14 | 286 |
GO:004427019 | Esophagus | ESCC | cellular nitrogen compound catabolic process | 288/8552 | 451/18723 | 3.03e-15 | 1.79e-13 | 288 |
GO:001943918 | Esophagus | ESCC | aromatic compound catabolic process | 295/8552 | 467/18723 | 1.09e-14 | 5.98e-13 | 295 |
GO:190136118 | Esophagus | ESCC | organic cyclic compound catabolic process | 307/8552 | 495/18723 | 9.99e-14 | 4.80e-12 | 307 |
GO:006101319 | Esophagus | ESCC | regulation of mRNA catabolic process | 115/8552 | 166/18723 | 5.90e-10 | 1.49e-08 | 115 |
GO:004348719 | Esophagus | ESCC | regulation of RNA stability | 117/8552 | 170/18723 | 7.91e-10 | 1.94e-08 | 117 |
GO:004348819 | Esophagus | ESCC | regulation of mRNA stability | 109/8552 | 158/18723 | 2.40e-09 | 5.35e-08 | 109 |
GO:00009592 | Esophagus | ESCC | mitochondrial RNA metabolic process | 39/8552 | 49/18723 | 1.20e-06 | 1.49e-05 | 39 |
GO:00009631 | Esophagus | ESCC | mitochondrial RNA processing | 19/8552 | 20/18723 | 3.83e-06 | 4.14e-05 | 19 |
GO:190136111 | Liver | Cirrhotic | organic cyclic compound catabolic process | 213/4634 | 495/18723 | 1.58e-19 | 3.67e-17 | 213 |
GO:001943911 | Liver | Cirrhotic | aromatic compound catabolic process | 202/4634 | 467/18723 | 6.93e-19 | 1.28e-16 | 202 |
GO:190331111 | Liver | Cirrhotic | regulation of mRNA metabolic process | 140/4634 | 288/18723 | 1.07e-18 | 1.91e-16 | 140 |
GO:004427011 | Liver | Cirrhotic | cellular nitrogen compound catabolic process | 195/4634 | 451/18723 | 2.99e-18 | 4.94e-16 | 195 |
GO:004670011 | Liver | Cirrhotic | heterocycle catabolic process | 192/4634 | 445/18723 | 7.17e-18 | 1.12e-15 | 192 |
GO:003465511 | Liver | Cirrhotic | nucleobase-containing compound catabolic process | 171/4634 | 407/18723 | 9.07e-15 | 9.33e-13 | 171 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
TBRG4 | SNV | Missense_Mutation | novel | c.1607N>A | p.Pro536His | p.P536H | Q969Z0 | protein_coding | deleterious(0.01) | probably_damaging(0.915) | TCGA-AR-A2LN-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | letrozole | SD |
TBRG4 | SNV | Missense_Mutation | novel | c.533N>G | p.Lys178Arg | p.K178R | Q969Z0 | protein_coding | tolerated(1) | benign(0.001) | TCGA-BH-A42T-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
TBRG4 | SNV | Missense_Mutation | rs143689271 | c.811C>T | p.Arg271Trp | p.R271W | Q969Z0 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-D8-A1J8-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | nolvadex | SD |
TBRG4 | insertion | In_Frame_Ins | novel | c.68_69insCAC | p.Met23delinsIleThr | p.M23delinsIT | Q969Z0 | protein_coding | | | TCGA-AR-A0TY-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unspecific | Paclitaxel | PD |
TBRG4 | insertion | Frame_Shift_Ins | novel | c.67_68insGAATTCA | p.Met23ArgfsTer17 | p.M23Rfs*17 | Q969Z0 | protein_coding | | | TCGA-AR-A0TY-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unspecific | Paclitaxel | PD |
TBRG4 | insertion | In_Frame_Ins | novel | c.1570_1571insGTC | p.Ala524delinsGlyPro | p.A524delinsGP | Q969Z0 | protein_coding | | | TCGA-B6-A0IN-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
TBRG4 | insertion | Nonsense_Mutation | novel | c.1568_1569insGGCTTCCTGATAGTGGACGTGAGTACCTCTTGGGCAGG | p.Asp523GlufsTer4 | p.D523Efs*4 | Q969Z0 | protein_coding | | | TCGA-B6-A0IN-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
TBRG4 | deletion | In_Frame_Del | | c.606_659delGCTGCTGGCTGAGCTGCTCACACACCTGGAAAGGCGTTGGACAGAAATTGAAGA | p.Glu202_Glu219del | p.E202_E219del | Q969Z0 | protein_coding | | | TCGA-E2-A1LH-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | SD |
TBRG4 | SNV | Missense_Mutation | novel | c.337G>C | p.Glu113Gln | p.E113Q | Q969Z0 | protein_coding | tolerated(0.16) | benign(0.08) | TCGA-HM-A4S6-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | CR |
TBRG4 | SNV | Missense_Mutation | | c.776N>A | p.Arg259Gln | p.R259Q | Q969Z0 | protein_coding | tolerated(0.05) | probably_damaging(0.974) | TCGA-A6-3809-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |