|
|||||
|
 | |
| |
| |
| |
| |
| |
|
Gene: SWI5 |
Gene summary for SWI5 |
 Gene summary. |
| Gene information | Species | Human | Gene symbol | SWI5 | Gene ID | 375757 |
| Gene name | SWI5 homologous recombination repair protein | |
| Gene Alias | C9orf119 | |
| Cytomap | 9q34.11 | |
| Gene Type | protein-coding | GO ID | GO:0000724 | UniProtAcc | Q1ZZU3 |
Top |
Malignant transformation analysis |
| Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
| Malignant transformation involving gene list. |
| Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
| 375757 | SWI5 | LZE4T | Human | Esophagus | ESCC | 4.46e-16 | 4.42e-01 | 0.0811 |
| 375757 | SWI5 | LZE5T | Human | Esophagus | ESCC | 5.35e-05 | 3.25e-01 | 0.0514 |
| 375757 | SWI5 | LZE7T | Human | Esophagus | ESCC | 3.29e-14 | 7.46e-01 | 0.0667 |
| 375757 | SWI5 | LZE8T | Human | Esophagus | ESCC | 3.24e-06 | 2.73e-01 | 0.067 |
| 375757 | SWI5 | LZE20T | Human | Esophagus | ESCC | 1.37e-11 | 5.78e-01 | 0.0662 |
| 375757 | SWI5 | LZE22D1 | Human | Esophagus | HGIN | 7.56e-03 | 1.91e-01 | 0.0595 |
| 375757 | SWI5 | LZE24T | Human | Esophagus | ESCC | 7.01e-26 | 6.68e-01 | 0.0596 |
| 375757 | SWI5 | LZE21T | Human | Esophagus | ESCC | 6.02e-11 | 6.95e-01 | 0.0655 |
| 375757 | SWI5 | LZE6T | Human | Esophagus | ESCC | 5.35e-15 | 8.22e-01 | 0.0845 |
| 375757 | SWI5 | P1T-E | Human | Esophagus | ESCC | 1.74e-10 | 6.06e-01 | 0.0875 |
| 375757 | SWI5 | P2T-E | Human | Esophagus | ESCC | 1.93e-44 | 8.41e-01 | 0.1177 |
| 375757 | SWI5 | P4T-E | Human | Esophagus | ESCC | 1.10e-52 | 1.15e+00 | 0.1323 |
| 375757 | SWI5 | P5T-E | Human | Esophagus | ESCC | 6.92e-23 | 3.55e-01 | 0.1327 |
| 375757 | SWI5 | P8T-E | Human | Esophagus | ESCC | 1.62e-31 | 5.70e-01 | 0.0889 |
| 375757 | SWI5 | P9T-E | Human | Esophagus | ESCC | 1.91e-26 | 5.67e-01 | 0.1131 |
| 375757 | SWI5 | P10T-E | Human | Esophagus | ESCC | 8.44e-43 | 6.85e-01 | 0.116 |
| 375757 | SWI5 | P11T-E | Human | Esophagus | ESCC | 4.81e-25 | 7.72e-01 | 0.1426 |
| 375757 | SWI5 | P12T-E | Human | Esophagus | ESCC | 5.98e-33 | 5.98e-01 | 0.1122 |
| 375757 | SWI5 | P15T-E | Human | Esophagus | ESCC | 2.18e-21 | 4.62e-01 | 0.1149 |
| 375757 | SWI5 | P16T-E | Human | Esophagus | ESCC | 6.52e-34 | 5.38e-01 | 0.1153 |
| Page: 1 2 3 4 5 6 |
| Transcriptomic changes along malignancy continuum. |
| Tissue | Expression Dynamics | Abbreviation |
| Esophagus |  | ESCC: Esophageal squamous cell carcinoma |
| HGIN: High-grade intraepithelial neoplasias | ||
| LGIN: Low-grade intraepithelial neoplasias | ||
| Liver |  | HCC: Hepatocellular carcinoma |
| NAFLD: Non-alcoholic fatty liver disease | ||
| Oral Cavity |  | EOLP: Erosive Oral lichen planus |
| LP: leukoplakia | ||
| NEOLP: Non-erosive oral lichen planus | ||
| OSCC: Oral squamous cell carcinoma | ||
| Prostate |  | BPH: Benign Prostatic Hyperplasia |
| Skin |  | AK: Actinic keratosis |
| cSCC: Cutaneous squamous cell carcinoma | ||
| SCCIS:squamous cell carcinoma in situ | ||
| Thyroid |  | ATC: Anaplastic thyroid cancer |
| HT: Hashimoto's thyroiditis | ||
| PTC: Papillary thyroid cancer |
| ∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
| Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
| Figure of enriched GO biological processes. |
| Tissue | Disease Stage | Enriched GO biological Processes |
| Colorectum | AD |  |
| Colorectum | SER |  |
| Colorectum | MSS |  |
| Colorectum | MSI-H |  |
| Colorectum | FAP |  |
| ∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched GO biological processes. |
| GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
| GO:007147919 | Esophagus | HGIN | cellular response to ionizing radiation | 21/2587 | 72/18723 | 5.31e-04 | 7.59e-03 | 21 |
| GO:000931418 | Esophagus | HGIN | response to radiation | 88/2587 | 456/18723 | 6.26e-04 | 8.65e-03 | 88 |
| GO:00714789 | Esophagus | HGIN | cellular response to radiation | 42/2587 | 186/18723 | 7.66e-04 | 1.00e-02 | 42 |
| GO:007121418 | Esophagus | HGIN | cellular response to abiotic stimulus | 66/2587 | 331/18723 | 1.21e-03 | 1.45e-02 | 66 |
| GO:010400418 | Esophagus | HGIN | cellular response to environmental stimulus | 66/2587 | 331/18723 | 1.21e-03 | 1.45e-02 | 66 |
| GO:00102129 | Esophagus | HGIN | response to ionizing radiation | 33/2587 | 148/18723 | 3.28e-03 | 3.10e-02 | 33 |
| GO:001021217 | Esophagus | ESCC | response to ionizing radiation | 110/8552 | 148/18723 | 1.11e-12 | 4.78e-11 | 110 |
| GO:000931419 | Esophagus | ESCC | response to radiation | 277/8552 | 456/18723 | 4.42e-11 | 1.43e-09 | 277 |
| GO:007121419 | Esophagus | ESCC | cellular response to abiotic stimulus | 206/8552 | 331/18723 | 7.52e-10 | 1.88e-08 | 206 |
| GO:010400419 | Esophagus | ESCC | cellular response to environmental stimulus | 206/8552 | 331/18723 | 7.52e-10 | 1.88e-08 | 206 |
| GO:007147816 | Esophagus | ESCC | cellular response to radiation | 122/8552 | 186/18723 | 3.07e-08 | 5.73e-07 | 122 |
| GO:0071479110 | Esophagus | ESCC | cellular response to ionizing radiation | 54/8552 | 72/18723 | 3.85e-07 | 5.32e-06 | 54 |
| GO:00063024 | Esophagus | ESCC | double-strand break repair | 152/8552 | 251/18723 | 1.33e-06 | 1.62e-05 | 152 |
| GO:00063101 | Esophagus | ESCC | DNA recombination | 168/8552 | 305/18723 | 5.58e-04 | 3.05e-03 | 168 |
| GO:00007241 | Esophagus | ESCC | double-strand break repair via homologous recombination | 79/8552 | 138/18723 | 4.05e-03 | 1.62e-02 | 79 |
| GO:00007251 | Esophagus | ESCC | recombinational repair | 80/8552 | 140/18723 | 4.10e-03 | 1.63e-02 | 80 |
| GO:007121411 | Liver | Cirrhotic | cellular response to abiotic stimulus | 115/4634 | 331/18723 | 2.62e-05 | 3.38e-04 | 115 |
| GO:010400411 | Liver | Cirrhotic | cellular response to environmental stimulus | 115/4634 | 331/18723 | 2.62e-05 | 3.38e-04 | 115 |
| GO:007147911 | Liver | Cirrhotic | cellular response to ionizing radiation | 34/4634 | 72/18723 | 2.86e-05 | 3.64e-04 | 34 |
| GO:007147811 | Liver | Cirrhotic | cellular response to radiation | 68/4634 | 186/18723 | 2.11e-04 | 1.94e-03 | 68 |
| Page: 1 2 3 4 5 |
| Enriched KEGG pathways. |
| Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
| Page: 1 |
Top |
Cell-cell communication analysis |
| Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
| Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
| Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
| Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
| TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
| ∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
| Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
| Annotation of somatic variants for genes involved in malignant transformation |
| Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
| SWI5 | SNV | Missense_Mutation | novel | c.149N>C | p.Arg50Thr | p.R50T | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.28) | benign(0.01) | TCGA-5L-AAT1-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Hormone Therapy | letrozol | SD |
| SWI5 | SNV | Missense_Mutation | c.100N>T | p.Pro34Ser | p.P34S | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.54) | benign(0.021) | TCGA-D8-A27V-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | tamoxiphen | SD | |
| SWI5 | SNV | Missense_Mutation | c.158N>A | p.Gly53Asp | p.G53D | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.65) | benign(0) | TCGA-E9-A22E-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | cyclophosphane | SD | |
| SWI5 | deletion | Frame_Shift_Del | c.28_47delTGGCGTCACAACAAAAGCTG | p.Trp10ArgfsTer110 | p.W10Rfs*110 | Q1ZZU3 | protein_coding | TCGA-AN-A0AR-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |||
| SWI5 | SNV | Missense_Mutation | rs758005489 | c.28N>C | p.Trp10Arg | p.W10R | Q1ZZU3 | protein_coding | deleterious_low_confidence(0) | benign(0.001) | TCGA-JX-A3Q0-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Unknown | Unknown | SD |
| SWI5 | SNV | Missense_Mutation | c.83N>T | p.Arg28Met | p.R28M | Q1ZZU3 | protein_coding | deleterious_low_confidence(0.04) | benign(0.043) | TCGA-AD-6888-01 | Colorectum | colon adenocarcinoma | Male | >=65 | III/IV | Unknown | Unknown | PD | |
| SWI5 | SNV | Missense_Mutation | c.137N>T | p.Thr46Ile | p.T46I | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.12) | benign(0) | TCGA-AZ-6599-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD | |
| SWI5 | SNV | Missense_Mutation | c.154C>T | p.Pro52Ser | p.P52S | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.28) | benign(0.003) | TCGA-CM-4743-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Chemotherapy | capecitabine | SD | |
| SWI5 | SNV | Missense_Mutation | novel | c.452N>T | p.Ala151Val | p.A151V | Q1ZZU3 | protein_coding | tolerated(0.07) | possibly_damaging(0.71) | TCGA-A5-A0G1-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
| SWI5 | SNV | Missense_Mutation | novel | c.624N>T | p.Gln208His | p.Q208H | Q1ZZU3 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-A5-A0G2-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
| Page: 1 2 3 |
Top |
Related drugs of malignant transformation related genes |
| Identification of chemicals and drugs interact with genes involved in malignant transfromation |
| (DGIdb 4.0) |
| Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
| Page: 1 |
Copyright 2023-Present -The University of Texas Health Science Center at Houston |