Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: STK40

Gene summary for STK40

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

STK40

Gene ID

83931

Gene nameserine/threonine kinase 40
Gene AliasSHIK
Cytomap1p34.3
Gene Typeprotein-coding
GO ID

GO:0000165

UniProtAcc

Q8N2I9


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
83931STK40HTA11_2487_2000001011HumanColorectumSER2.19e-023.77e-01-0.1808
83931STK40HTA11_1938_2000001011HumanColorectumAD5.06e-033.31e-01-0.0811
83931STK40HTA11_347_2000001011HumanColorectumAD1.09e-063.94e-01-0.1954
83931STK40HTA11_83_2000001011HumanColorectumSER5.63e-034.44e-01-0.1526
83931STK40HTA11_696_2000001011HumanColorectumAD4.14e-033.04e-01-0.1464
83931STK40HTA11_1391_2000001011HumanColorectumAD1.45e-033.65e-01-0.059
83931STK40HTA11_99999971662_82457HumanColorectumMSS1.02e-045.04e-010.3859
83931STK40A015-C-203HumanColorectumFAP1.51e-05-1.50e-01-0.1294
83931STK40A001-C-108HumanColorectumFAP1.39e-02-1.14e-01-0.0272
83931STK40A015-C-106HumanColorectumFAP5.65e-04-1.36e-01-0.0511
83931STK40A002-C-114HumanColorectumFAP2.97e-02-1.83e-01-0.1561
83931STK40A015-C-104HumanColorectumFAP2.06e-08-1.85e-01-0.1899
83931STK40A002-C-016HumanColorectumFAP1.53e-04-1.35e-010.0521
83931STK40A002-C-116HumanColorectumFAP6.58e-09-1.85e-01-0.0452
83931STK40A018-E-020HumanColorectumFAP3.75e-02-1.52e-01-0.2034
83931STK40F034HumanColorectumFAP1.29e-05-1.62e-01-0.0665
83931STK40F072BHumanColorectumFAP3.44e-03-1.49e-010.257
83931STK40LZE8THumanEsophagusESCC3.45e-05-2.20e-030.067
83931STK40LZE20THumanEsophagusESCC1.53e-052.89e-020.0662
83931STK40LZE22THumanEsophagusESCC3.00e-031.34e-010.068
Page: 1 2 3 4 5 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
Colorectum (GSE201348)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.FAP: Familial adenomatous polyposis
CRC: Colorectal cancer
Colorectum (HTA11)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AD: Adenomas
SER: Sessile serrated lesions
MSI-H: Microsatellite-high colorectal cancer
MSS: Microsatellite stable colorectal cancer
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
LiverThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.HCC: Hepatocellular carcinoma
NAFLD: Non-alcoholic fatty liver disease
LungThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AAH: Atypical adenomatous hyperplasia
AIS: Adenocarcinoma in situ
IAC: Invasive lung adenocarcinoma
MIA: Minimally invasive adenocarcinoma
ProstateThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.BPH: Benign Prostatic Hyperplasia
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:0006091ColorectumADgeneration of precursor metabolites and energy209/3918490/187233.17e-286.61e-25209
GO:0015980ColorectumADenergy derivation by oxidation of organic compounds143/3918318/187232.78e-222.49e-19143
GO:0044262ColorectumADcellular carbohydrate metabolic process87/3918283/187236.00e-051.01e-0387
GO:0060425ColorectumADlung morphogenesis20/391850/187231.65e-031.38e-0220
GO:00060911ColorectumSERgeneration of precursor metabolites and energy168/2897490/187231.39e-251.70e-22168
GO:00159801ColorectumSERenergy derivation by oxidation of organic compounds119/2897318/187235.28e-224.62e-19119
GO:00060912ColorectumMSSgeneration of precursor metabolites and energy186/3467490/187231.14e-242.15e-21186
GO:00159802ColorectumMSSenergy derivation by oxidation of organic compounds131/3467318/187232.60e-212.70e-18131
GO:00604251ColorectumMSSlung morphogenesis20/346750/187233.25e-044.21e-0320
GO:0035264ColorectumMSSmulticellular organism growth37/3467132/187234.77e-033.34e-0237
GO:00060914ColorectumFAPgeneration of precursor metabolites and energy128/2622490/187235.58e-134.28e-10128
GO:00159804ColorectumFAPenergy derivation by oxidation of organic compounds85/2622318/187231.36e-092.77e-0785
GO:00442621ColorectumFAPcellular carbohydrate metabolic process66/2622283/187231.53e-054.01e-0466
GO:00604252ColorectumFAPlung morphogenesis16/262250/187239.14e-049.20e-0316
GO:00352641ColorectumFAPmulticellular organism growth31/2622132/187232.28e-031.84e-0231
GO:0030323ColorectumFAPrespiratory tube development39/2622181/187233.60e-032.58e-0239
GO:0030324ColorectumFAPlung development38/2622177/187234.28e-032.93e-0238
GO:0006091110EsophagusESCCgeneration of precursor metabolites and energy331/8552490/187233.86e-238.45e-21331
GO:0015980110EsophagusESCCenergy derivation by oxidation of organic compounds220/8552318/187231.20e-171.09e-15220
GO:00303239EsophagusESCCrespiratory tube development112/8552181/187237.82e-067.69e-05112
Page: 1 2 3 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
STK40SNVMissense_Mutationnovelc.511N>Cp.Glu171Glnp.E171QQ8N2I9protein_codingtolerated(0.14)probably_damaging(0.929)TCGA-AR-A2LE-01Breastbreast invasive carcinomaFemale>=65I/IIHormone TherapytamoxiphenPD
STK40SNVMissense_Mutationrs754087375c.1261N>Ap.Asp421Asnp.D421NQ8N2I9protein_codingdeleterious_low_confidence(0.01)possibly_damaging(0.883)TCGA-BH-A18S-01Breastbreast invasive carcinomaFemale>=65I/IIUnknownUnknownSD
STK40SNVMissense_Mutationc.714N>Cp.Gln238Hisp.Q238HQ8N2I9protein_codingdeleterious(0)probably_damaging(0.939)TCGA-C8-A274-01Breastbreast invasive carcinomaFemale<65I/IIHormone TherapytamoxiphenSD
STK40deletionFrame_Shift_Delc.891delCp.Ile298PhefsTer49p.I298Ffs*49Q8N2I9protein_codingTCGA-D8-A27V-01Breastbreast invasive carcinomaFemale<65I/IIHormone TherapytamoxiphenSD
STK40insertionIn_Frame_Insnovelc.67_102dupGGGATTTCTGGAAATAATGCAAAGAGAGCTGGACCAp.Gly23_Pro34dupp.G23_P34dupQ8N2I9protein_codingTCGA-E9-A2JS-01Breastbreast invasive carcinomaFemale>=65I/IIChemotherapycyclophosphamidePD
STK40SNVMissense_Mutationnovelc.422N>Ap.Arg141Hisp.R141HQ8N2I9protein_codingdeleterious(0)probably_damaging(0.992)TCGA-C5-A1MH-01Cervixcervical & endocervical cancerFemale>=65III/IVChemotherapycisplatinPD
STK40SNVMissense_Mutationnovelc.445C>Ap.Leu149Ilep.L149IQ8N2I9protein_codingdeleterious(0.02)possibly_damaging(0.814)TCGA-AA-3949-01Colorectumcolon adenocarcinomaFemale>=65III/IVUnknownUnknownSD
STK40SNVMissense_Mutationrs773276972c.745N>Ap.Val249Metp.V249MQ8N2I9protein_codingdeleterious(0)probably_damaging(0.947)TCGA-CK-4947-01Colorectumcolon adenocarcinomaFemale<65III/IVOther, specify in notesfolinicSD
STK40SNVMissense_Mutationrs150712193c.767G>Ap.Arg256Hisp.R256HQ8N2I9protein_codingtolerated(0.53)benign(0.365)TCGA-CK-4951-01Colorectumcolon adenocarcinomaFemale>=65I/IIUnknownUnknownPD
STK40SNVMissense_Mutationc.296A>Gp.Tyr99Cysp.Y99CQ8N2I9protein_codingdeleterious(0)probably_damaging(0.971)TCGA-CK-4951-01Colorectumcolon adenocarcinomaFemale>=65I/IIUnknownUnknownPD
Page: 1 2 3 4 5 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1