Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: SNRPF

Gene summary for SNRPF

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

SNRPF

Gene ID

6636

Gene namesmall nuclear ribonucleoprotein polypeptide F
Gene AliasSMF
Cytomap12q23.1
Gene Typeprotein-coding
GO ID

GO:0000375

UniProtAcc

P62306


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
6636SNRPFGSM4909282HumanBreastIDC3.09e-043.45e-01-0.0288
6636SNRPFGSM4909285HumanBreastIDC2.74e-164.99e-010.21
6636SNRPFGSM4909286HumanBreastIDC2.29e-063.97e-010.1081
6636SNRPFGSM4909288HumanBreastIDC1.28e-021.49e-010.0988
6636SNRPFGSM4909290HumanBreastIDC8.41e-044.14e-010.2096
6636SNRPFGSM4909293HumanBreastIDC1.06e-043.36e-010.1581
6636SNRPFGSM4909294HumanBreastIDC6.19e-295.52e-010.2022
6636SNRPFGSM4909296HumanBreastIDC7.11e-212.55e-010.1524
6636SNRPFGSM4909297HumanBreastIDC2.15e-23-3.52e-020.1517
6636SNRPFGSM4909301HumanBreastIDC7.23e-052.73e-010.1577
6636SNRPFGSM4909304HumanBreastIDC1.08e-052.75e-010.1636
6636SNRPFGSM4909309HumanBreastIDC1.42e-061.50e-010.0483
6636SNRPFGSM4909311HumanBreastIDC4.71e-38-3.01e-010.1534
6636SNRPFGSM4909312HumanBreastIDC4.74e-14-1.61e-010.1552
6636SNRPFGSM4909313HumanBreastIDC1.18e-05-1.93e-010.0391
6636SNRPFGSM4909315HumanBreastIDC8.95e-235.84e-010.21
6636SNRPFGSM4909316HumanBreastIDC3.04e-115.03e-010.21
6636SNRPFGSM4909318HumanBreastIDC1.67e-023.99e-010.2031
6636SNRPFGSM4909319HumanBreastIDC8.99e-48-3.46e-010.1563
6636SNRPFGSM4909320HumanBreastIDC8.73e-06-2.27e-010.1575
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
BreastThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.IDC: Invasive ductal carcinoma
DCIS: Ductal carcinoma in situ
Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers
CervixThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.CC: Cervix cancer
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions
N_HPV: HPV-infected normal cervix
Colorectum (GSE201348)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.FAP: Familial adenomatous polyposis
CRC: Colorectal cancer
Colorectum (HTA11)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AD: Adenomas
SER: Sessile serrated lesions
MSI-H: Microsatellite-high colorectal cancer
MSS: Microsatellite stable colorectal cancer
EndometriumThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AEH: Atypical endometrial hyperplasia
EEC: Endometrioid Cancer
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
GCThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.CAG: Chronic atrophic gastritis
CAG with IM: Chronic atrophic gastritis with intestinal metaplasia
CSG: Chronic superficial gastritis
GC: Gastric cancer
SIM: Severe intestinal metaplasia
WIM: Wild intestinal metaplasia
LiverThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.HCC: Hepatocellular carcinoma
NAFLD: Non-alcoholic fatty liver disease
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
ProstateThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.BPH: Benign Prostatic Hyperplasia
SkinThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AK: Actinic keratosis
cSCC: Cutaneous squamous cell carcinoma
SCCIS:squamous cell carcinoma in situ
ThyroidThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ATC: Anaplastic thyroid cancer
HT: Hashimoto's thyroiditis
PTC: Papillary thyroid cancer
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:00226139BreastPrecancerribonucleoprotein complex biogenesis79/1080463/187232.11e-181.03e-1579
GO:00718269BreastPrecancerribonucleoprotein complex subunit organization48/1080227/187232.68e-158.45e-1348
GO:00226189BreastPrecancerribonucleoprotein complex assembly47/1080220/187233.47e-151.03e-1247
GO:00083809BreastPrecancerRNA splicing65/1080434/187231.27e-122.53e-1065
GO:00003759BreastPrecancerRNA splicing, via transesterification reactions52/1080324/187231.74e-112.22e-0952
GO:00003779BreastPrecancerRNA splicing, via transesterification reactions with bulged adenosine as nucleophile51/1080320/187233.55e-114.04e-0951
GO:00003989BreastPrecancermRNA splicing, via spliceosome51/1080320/187233.55e-114.04e-0951
GO:00003873BreastPrecancerspliceosomal snRNP assembly10/108050/187234.86e-046.35e-0310
GO:002261314BreastIDCribonucleoprotein complex biogenesis83/1434463/187232.01e-135.20e-1183
GO:007182614BreastIDCribonucleoprotein complex subunit organization52/1434227/187235.18e-131.21e-1052
GO:002261814BreastIDCribonucleoprotein complex assembly51/1434220/187235.32e-131.21e-1051
GO:000838014BreastIDCRNA splicing73/1434434/187231.27e-101.57e-0873
GO:000037514BreastIDCRNA splicing, via transesterification reactions58/1434324/187239.44e-109.58e-0858
GO:000037714BreastIDCRNA splicing, via transesterification reactions with bulged adenosine as nucleophile57/1434320/187231.60e-091.49e-0757
GO:000039814BreastIDCmRNA splicing, via spliceosome57/1434320/187231.60e-091.49e-0757
GO:000038711BreastIDCspliceosomal snRNP assembly11/143450/187231.18e-031.28e-0211
GO:002261324BreastDCISribonucleoprotein complex biogenesis83/1390463/187233.65e-141.09e-1183
GO:007182624BreastDCISribonucleoprotein complex subunit organization52/1390227/187231.54e-133.95e-1152
GO:002261824BreastDCISribonucleoprotein complex assembly51/1390220/187231.60e-133.95e-1151
GO:000838024BreastDCISRNA splicing73/1390434/187233.05e-115.08e-0973
Page: 1 2 3 4 5 6 7 8 9 10 11 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
hsa030408BreastPrecancerSpliceosome39/684217/84651.44e-062.27e-051.74e-0539
hsa0304013BreastPrecancerSpliceosome39/684217/84651.44e-062.27e-051.74e-0539
hsa0304023BreastIDCSpliceosome40/867217/84651.53e-041.42e-031.06e-0340
hsa0304033BreastIDCSpliceosome40/867217/84651.53e-041.42e-031.06e-0340
hsa0304043BreastDCISSpliceosome40/846217/84658.97e-058.52e-046.28e-0440
hsa0304053BreastDCISSpliceosome40/846217/84658.97e-058.52e-046.28e-0440
hsa03040ColorectumADSpliceosome73/2092217/84651.73e-039.68e-036.18e-0373
hsa030401ColorectumADSpliceosome73/2092217/84651.73e-039.68e-036.18e-0373
hsa030402ColorectumMSSSpliceosome66/1875217/84652.58e-031.27e-027.81e-0366
hsa030403ColorectumMSSSpliceosome66/1875217/84652.58e-031.27e-027.81e-0366
hsa030404ColorectumMSI-HSpliceosome37/797217/84652.49e-043.23e-032.70e-0337
hsa030405ColorectumMSI-HSpliceosome37/797217/84652.49e-043.23e-032.70e-0337
hsa030409EndometriumAEHSpliceosome54/1197217/84651.47e-051.65e-041.21e-0454
hsa0304014EndometriumAEHSpliceosome54/1197217/84651.47e-051.65e-041.21e-0454
hsa0304024EndometriumEECSpliceosome54/1237217/84653.78e-053.88e-042.89e-0454
hsa0304034EndometriumEECSpliceosome54/1237217/84653.78e-053.88e-042.89e-0454
hsa0304027EsophagusESCCSpliceosome128/4205217/84653.31e-038.79e-034.50e-03128
hsa0304037EsophagusESCCSpliceosome128/4205217/84653.31e-038.79e-034.50e-03128
hsa030407LiverCirrhoticSpliceosome102/2530217/84655.69e-089.47e-075.84e-07102
hsa0304012LiverCirrhoticSpliceosome102/2530217/84655.69e-089.47e-075.84e-07102
Page: 1 2 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
SNRPFSNVMissense_Mutationnovelc.52N>Tp.Pro18Serp.P18SP62306protein_codingtolerated(0.17)benign(0.021)TCGA-AP-A1DK-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIUnknownUnknownSD
SNRPFSNVMissense_Mutationnovelc.119T>Cp.Met40Thrp.M40TP62306protein_codingdeleterious(0)probably_damaging(0.978)TCGA-EO-A22R-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIUnknownUnknownSD
SNRPFdeletionIn_Frame_Delnovelc.62_82delTGAAACTTAAGTGGGGAATGGp.Val21_Met27delp.V21_M27delP62306protein_codingTCGA-CC-A7IJ-01Liverliver hepatocellular carcinomaMale<65I/IIUnknownUnknownSD
SNRPFSNVMissense_Mutationc.169N>Ap.Gly57Argp.G57RP62306protein_codingdeleterious(0.01)possibly_damaging(0.77)TCGA-33-6737-01Lunglung squamous cell carcinomaMale>=65III/IVChemotherapygemcitabinePD
Page: 1 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1