![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: ROGDI |
Gene summary for ROGDI |
![]() |
Gene information | Species | Human | Gene symbol | ROGDI | Gene ID | 79641 |
Gene name | rogdi atypical leucine zipper | |
Gene Alias | KTZS | |
Cytomap | 16p13.3 | |
Gene Type | protein-coding | GO ID | GO:0002376 | UniProtAcc | Q9GZN7 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
79641 | ROGDI | LZE8T | Human | Esophagus | ESCC | 3.78e-06 | 2.54e-01 | 0.067 |
79641 | ROGDI | LZE20T | Human | Esophagus | ESCC | 1.11e-10 | 2.49e-01 | 0.0662 |
79641 | ROGDI | LZE22D1 | Human | Esophagus | HGIN | 2.70e-02 | 1.08e-01 | 0.0595 |
79641 | ROGDI | LZE22T | Human | Esophagus | ESCC | 8.04e-09 | 3.98e-01 | 0.068 |
79641 | ROGDI | LZE24T | Human | Esophagus | ESCC | 8.67e-18 | 3.63e-01 | 0.0596 |
79641 | ROGDI | LZE21T | Human | Esophagus | ESCC | 5.01e-03 | 2.29e-01 | 0.0655 |
79641 | ROGDI | P1T-E | Human | Esophagus | ESCC | 3.01e-11 | 4.33e-01 | 0.0875 |
79641 | ROGDI | P2T-E | Human | Esophagus | ESCC | 1.72e-24 | 5.16e-01 | 0.1177 |
79641 | ROGDI | P4T-E | Human | Esophagus | ESCC | 7.93e-22 | 4.36e-01 | 0.1323 |
79641 | ROGDI | P5T-E | Human | Esophagus | ESCC | 2.54e-11 | 3.13e-01 | 0.1327 |
79641 | ROGDI | P8T-E | Human | Esophagus | ESCC | 1.80e-24 | 5.21e-01 | 0.0889 |
79641 | ROGDI | P9T-E | Human | Esophagus | ESCC | 2.11e-07 | 8.97e-02 | 0.1131 |
79641 | ROGDI | P10T-E | Human | Esophagus | ESCC | 7.16e-11 | 1.85e-01 | 0.116 |
79641 | ROGDI | P11T-E | Human | Esophagus | ESCC | 8.90e-16 | 7.63e-01 | 0.1426 |
79641 | ROGDI | P12T-E | Human | Esophagus | ESCC | 2.08e-28 | 7.35e-01 | 0.1122 |
79641 | ROGDI | P15T-E | Human | Esophagus | ESCC | 4.03e-29 | 6.17e-01 | 0.1149 |
79641 | ROGDI | P16T-E | Human | Esophagus | ESCC | 1.51e-13 | 1.68e-01 | 0.1153 |
79641 | ROGDI | P17T-E | Human | Esophagus | ESCC | 6.42e-18 | 4.16e-01 | 0.1278 |
79641 | ROGDI | P20T-E | Human | Esophagus | ESCC | 1.20e-22 | 4.11e-01 | 0.1124 |
79641 | ROGDI | P21T-E | Human | Esophagus | ESCC | 2.79e-48 | 8.33e-01 | 0.1617 |
Page: 1 2 3 4 5 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ROGDI | SNV | Missense_Mutation | c.557C>A | p.Ser186Tyr | p.S186Y | Q9GZN7 | protein_coding | deleterious(0.03) | benign(0.291) | TCGA-A8-A07R-01 | Breast | breast invasive carcinoma | Female | >=65 | III/IV | Ancillary | zoledronic | SD | |
ROGDI | SNV | Missense_Mutation | novel | c.177G>T | p.Glu59Asp | p.E59D | Q9GZN7 | protein_coding | tolerated(0.23) | benign(0.374) | TCGA-AN-A046-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ROGDI | insertion | In_Frame_Ins | novel | c.754_783dupCCCTGGCTCAACGACGCCCTGGTCTACTTC | p.Pro252_Phe261dup | p.P252_F261dup | Q9GZN7 | protein_coding | TCGA-A7-A0DB-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | arimidex | SD | ||
ROGDI | SNV | Missense_Mutation | c.748N>A | p.Val250Met | p.V250M | Q9GZN7 | protein_coding | deleterious(0.03) | probably_damaging(0.998) | TCGA-EI-7002-01 | Colorectum | rectum adenocarcinoma | Male | <65 | III/IV | Chemotherapy | irinotecan+5-fluorouracilim | SD | |
ROGDI | SNV | Missense_Mutation | rs766106593 | c.811N>T | p.Leu271Phe | p.L271F | Q9GZN7 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-AJ-A3EK-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Chemotherapy | carboplatin | CR |
ROGDI | SNV | Missense_Mutation | novel | c.854N>C | p.Arg285Thr | p.R285T | Q9GZN7 | protein_coding | deleterious(0.01) | benign(0.154) | TCGA-AJ-A3QS-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Chemotherapy | cisplatin | CR |
ROGDI | SNV | Missense_Mutation | novel | c.503N>C | p.Leu168Pro | p.L168P | Q9GZN7 | protein_coding | deleterious(0.03) | probably_damaging(0.999) | TCGA-AP-A059-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ROGDI | SNV | Missense_Mutation | novel | c.791N>T | p.Ser264Phe | p.S264F | Q9GZN7 | protein_coding | deleterious(0) | probably_damaging(0.94) | TCGA-AX-A06F-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Chemotherapy | carboplatin | SD |
ROGDI | SNV | Missense_Mutation | novel | c.686N>A | p.Gly229Glu | p.G229E | Q9GZN7 | protein_coding | deleterious(0) | possibly_damaging(0.624) | TCGA-B5-A1MX-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Hormone Therapy | megace | SD |
ROGDI | SNV | Missense_Mutation | rs780893164 | c.470N>A | p.Arg157Gln | p.R157Q | Q9GZN7 | protein_coding | deleterious(0) | probably_damaging(0.997) | TCGA-BG-A0MQ-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
Page: 1 2 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |