|
|||||
|
 | |
| |
| |
| |
| |
| |
|
Gene: RBM14 |
Gene summary for RBM14 |
 Gene summary. |
| Gene information | Species | Human | Gene symbol | RBM14 | Gene ID | 10432 |
| Gene name | RNA binding motif protein 14 | |
| Gene Alias | COAA | |
| Cytomap | 11q13.2 | |
| Gene Type | protein-coding | GO ID | GO:0000226 | UniProtAcc | A0A0S2Z567 |
Top |
Malignant transformation analysis |
| Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
| Malignant transformation involving gene list. |
| Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
| 10432 | RBM14 | HTA11_3410_2000001011 | Human | Colorectum | AD | 6.55e-04 | 1.28e-01 | 0.0155 |
| 10432 | RBM14 | HTA11_1938_2000001011 | Human | Colorectum | AD | 2.24e-04 | 1.86e-01 | -0.0811 |
| 10432 | RBM14 | HTA11_78_2000001011 | Human | Colorectum | AD | 2.20e-05 | 1.60e-01 | -0.1088 |
| 10432 | RBM14 | HTA11_347_2000001011 | Human | Colorectum | AD | 7.02e-07 | 1.55e-01 | -0.1954 |
| 10432 | RBM14 | HTA11_411_2000001011 | Human | Colorectum | SER | 5.61e-03 | 2.55e-01 | -0.2602 |
| 10432 | RBM14 | HTA11_3361_2000001011 | Human | Colorectum | AD | 5.46e-03 | 1.69e-01 | -0.1207 |
| 10432 | RBM14 | HTA11_83_2000001011 | Human | Colorectum | SER | 2.04e-02 | 1.35e-01 | -0.1526 |
| 10432 | RBM14 | HTA11_696_2000001011 | Human | Colorectum | AD | 4.46e-07 | 1.63e-01 | -0.1464 |
| 10432 | RBM14 | HTA11_866_2000001011 | Human | Colorectum | AD | 1.71e-02 | 9.74e-02 | -0.1001 |
| 10432 | RBM14 | HTA11_1391_2000001011 | Human | Colorectum | AD | 3.65e-10 | 2.44e-01 | -0.059 |
| 10432 | RBM14 | HTA11_5216_2000001011 | Human | Colorectum | SER | 3.40e-02 | 1.93e-01 | -0.1462 |
| 10432 | RBM14 | HTA11_866_3004761011 | Human | Colorectum | AD | 1.36e-07 | 1.83e-01 | 0.096 |
| 10432 | RBM14 | HTA11_10623_2000001011 | Human | Colorectum | AD | 8.98e-03 | 1.87e-01 | -0.0177 |
| 10432 | RBM14 | HTA11_6801_2000001011 | Human | Colorectum | SER | 2.21e-02 | 3.87e-01 | 0.0171 |
| 10432 | RBM14 | HTA11_7696_3000711011 | Human | Colorectum | AD | 9.32e-10 | 2.13e-01 | 0.0674 |
| 10432 | RBM14 | HTA11_7469_2000001011 | Human | Colorectum | AD | 3.81e-02 | 2.45e-01 | -0.0124 |
| 10432 | RBM14 | HTA11_6818_2000001021 | Human | Colorectum | AD | 2.64e-03 | 1.45e-01 | 0.0588 |
| 10432 | RBM14 | HTA11_99999970781_79442 | Human | Colorectum | MSS | 2.05e-06 | 1.74e-01 | 0.294 |
| 10432 | RBM14 | HTA11_99999965062_69753 | Human | Colorectum | MSI-H | 5.36e-07 | 5.36e-01 | 0.3487 |
| 10432 | RBM14 | HTA11_99999965104_69814 | Human | Colorectum | MSS | 7.49e-10 | 3.40e-01 | 0.281 |
| Page: 1 2 3 4 5 6 |
| Transcriptomic changes along malignancy continuum. |
| Tissue | Expression Dynamics | Abbreviation |
| Colorectum (GSE201348) |  | FAP: Familial adenomatous polyposis |
| CRC: Colorectal cancer | ||
| Colorectum (HTA11) |  | AD: Adenomas |
| SER: Sessile serrated lesions | ||
| MSI-H: Microsatellite-high colorectal cancer | ||
| MSS: Microsatellite stable colorectal cancer | ||
| Esophagus |  | ESCC: Esophageal squamous cell carcinoma |
| HGIN: High-grade intraepithelial neoplasias | ||
| LGIN: Low-grade intraepithelial neoplasias | ||
| Oral Cavity |  | EOLP: Erosive Oral lichen planus |
| LP: leukoplakia | ||
| NEOLP: Non-erosive oral lichen planus | ||
| OSCC: Oral squamous cell carcinoma | ||
| Skin |  | AK: Actinic keratosis |
| cSCC: Cutaneous squamous cell carcinoma | ||
| SCCIS:squamous cell carcinoma in situ | ||
| Thyroid |  | ATC: Anaplastic thyroid cancer |
| HT: Hashimoto's thyroiditis | ||
| PTC: Papillary thyroid cancer |
| ∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
| Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
| Figure of enriched GO biological processes. |
| Tissue | Disease Stage | Enriched GO biological Processes |
| Colorectum | AD |  |
| Colorectum | SER |  |
| Colorectum | MSS |  |
| Colorectum | MSI-H |  |
| Colorectum | FAP |  |
| ∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched GO biological processes. |
| GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
| GO:0008380 | Colorectum | AD | RNA splicing | 169/3918 | 434/18723 | 3.59e-18 | 2.04e-15 | 169 |
| GO:0000377 | Colorectum | AD | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 130/3918 | 320/18723 | 5.88e-16 | 2.16e-13 | 130 |
| GO:0000398 | Colorectum | AD | mRNA splicing, via spliceosome | 130/3918 | 320/18723 | 5.88e-16 | 2.16e-13 | 130 |
| GO:0000375 | Colorectum | AD | RNA splicing, via transesterification reactions | 131/3918 | 324/18723 | 7.11e-16 | 2.22e-13 | 131 |
| GO:0010639 | Colorectum | AD | negative regulation of organelle organization | 114/3918 | 348/18723 | 1.41e-07 | 6.49e-06 | 114 |
| GO:0051494 | Colorectum | AD | negative regulation of cytoskeleton organization | 58/3918 | 163/18723 | 1.04e-05 | 2.40e-04 | 58 |
| GO:0007178 | Colorectum | AD | transmembrane receptor protein serine/threonine kinase signaling pathway | 99/3918 | 355/18723 | 9.92e-04 | 9.28e-03 | 99 |
| GO:0060395 | Colorectum | AD | SMAD protein signal transduction | 28/3918 | 82/18723 | 3.73e-03 | 2.63e-02 | 28 |
| GO:0046605 | Colorectum | AD | regulation of centrosome cycle | 18/3918 | 49/18723 | 7.93e-03 | 4.73e-02 | 18 |
| GO:00083801 | Colorectum | SER | RNA splicing | 123/2897 | 434/18723 | 3.84e-12 | 8.41e-10 | 123 |
| GO:00003751 | Colorectum | SER | RNA splicing, via transesterification reactions | 90/2897 | 324/18723 | 8.68e-09 | 7.50e-07 | 90 |
| GO:00003771 | Colorectum | SER | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 89/2897 | 320/18723 | 9.82e-09 | 8.14e-07 | 89 |
| GO:00003981 | Colorectum | SER | mRNA splicing, via spliceosome | 89/2897 | 320/18723 | 9.82e-09 | 8.14e-07 | 89 |
| GO:00106391 | Colorectum | SER | negative regulation of organelle organization | 90/2897 | 348/18723 | 3.14e-07 | 1.69e-05 | 90 |
| GO:00514941 | Colorectum | SER | negative regulation of cytoskeleton organization | 48/2897 | 163/18723 | 4.34e-06 | 1.63e-04 | 48 |
| GO:00466051 | Colorectum | SER | regulation of centrosome cycle | 17/2897 | 49/18723 | 7.17e-04 | 9.44e-03 | 17 |
| GO:0010824 | Colorectum | SER | regulation of centrosome duplication | 15/2897 | 45/18723 | 2.29e-03 | 2.19e-02 | 15 |
| GO:00083802 | Colorectum | MSS | RNA splicing | 159/3467 | 434/18723 | 1.75e-19 | 1.22e-16 | 159 |
| GO:00003772 | Colorectum | MSS | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 121/3467 | 320/18723 | 2.52e-16 | 8.27e-14 | 121 |
| GO:00003982 | Colorectum | MSS | mRNA splicing, via spliceosome | 121/3467 | 320/18723 | 2.52e-16 | 8.27e-14 | 121 |
| Page: 1 2 3 4 5 6 7 8 |
| Enriched KEGG pathways. |
| Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
| Page: 1 |
Top |
Cell-cell communication analysis |
| Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
| Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
| Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
| Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
| TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
| ∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
| Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
| Annotation of somatic variants for genes involved in malignant transformation |
| Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
| RBM14 | SNV | Missense_Mutation | c.545N>G | p.Ser182Cys | p.S182C | Q96PK6 | protein_coding | deleterious(0.01) | probably_damaging(0.925) | TCGA-A8-A095-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | 5-fluorouracil | CR | |
| RBM14 | SNV | Missense_Mutation | c.674N>G | p.Ser225Cys | p.S225C | Q96PK6 | protein_coding | deleterious_low_confidence(0) | possibly_damaging(0.89) | TCGA-A8-A095-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | 5-fluorouracil | CR | |
| RBM14 | SNV | Missense_Mutation | c.1754N>A | p.Arg585Gln | p.R585Q | Q96PK6 | protein_coding | tolerated(0.1) | benign(0.003) | TCGA-AR-A24V-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | SD | |
| RBM14 | SNV | Missense_Mutation | rs764529837 | c.1220N>T | p.Ser407Leu | p.S407L | Q96PK6 | protein_coding | deleterious(0.01) | benign(0.019) | TCGA-D8-A27G-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
| RBM14 | SNV | Missense_Mutation | c.592T>C | p.Phe198Leu | p.F198L | Q96PK6 | protein_coding | deleterious(0.01) | benign(0.001) | TCGA-E2-A14R-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | PD | |
| RBM14 | SNV | Missense_Mutation | rs773352601 | c.938C>T | p.Ser313Leu | p.S313L | Q96PK6 | protein_coding | tolerated(0.22) | possibly_damaging(0.885) | TCGA-C5-A7UH-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | SD |
| RBM14 | SNV | Missense_Mutation | c.1436C>T | p.Ser479Leu | p.S479L | Q96PK6 | protein_coding | deleterious(0.02) | benign(0.018) | TCGA-C5-A7UH-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | SD | |
| RBM14 | SNV | Missense_Mutation | novel | c.280N>A | p.Glu94Lys | p.E94K | Q96PK6 | protein_coding | deleterious(0.03) | probably_damaging(0.93) | TCGA-C5-A8XH-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD |
| RBM14 | insertion | In_Frame_Ins | novel | c.414_434dupGGGCAAGCGCATCAACGTGGA | p.Gly139_Glu145dup | p.G139_E145dup | Q96PK6 | protein_coding | TCGA-Q1-A6DW-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | SD | ||
| RBM14 | SNV | Missense_Mutation | rs751672990 | c.608N>A | p.Arg203His | p.R203H | Q96PK6 | protein_coding | deleterious(0) | benign(0.049) | TCGA-5M-AAT6-01 | Colorectum | colon adenocarcinoma | Female | <65 | III/IV | Unknown | Unknown | PD |
| Page: 1 2 3 4 5 6 7 |
Top |
Related drugs of malignant transformation related genes |
| Identification of chemicals and drugs interact with genes involved in malignant transfromation |
| (DGIdb 4.0) |
| Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
| Page: 1 |
Copyright 2023-Present -The University of Texas Health Science Center at Houston |