|
|||||
|
 | |
| |
| |
| |
| |
| |
|
Gene: MSRB1 |
Gene summary for MSRB1 |
 Gene summary. |
| Gene information | Species | Human | Gene symbol | MSRB1 | Gene ID | 51734 |
| Gene name | methionine sulfoxide reductase B1 | |
| Gene Alias | HSPC270 | |
| Cytomap | 16p13.3 | |
| Gene Type | protein-coding | GO ID | GO:0002376 | UniProtAcc | Q9NZV6 |
Top |
Malignant transformation analysis |
| Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
| Malignant transformation involving gene list. |
| Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
| 51734 | MSRB1 | LZE2T | Human | Esophagus | ESCC | 3.97e-07 | 6.49e-01 | 0.082 |
| 51734 | MSRB1 | LZE4T | Human | Esophagus | ESCC | 1.35e-07 | 3.16e-01 | 0.0811 |
| 51734 | MSRB1 | LZE7T | Human | Esophagus | ESCC | 9.24e-09 | 5.04e-01 | 0.0667 |
| 51734 | MSRB1 | LZE8T | Human | Esophagus | ESCC | 3.26e-05 | 2.40e-01 | 0.067 |
| 51734 | MSRB1 | LZE20T | Human | Esophagus | ESCC | 6.46e-05 | 1.40e-01 | 0.0662 |
| 51734 | MSRB1 | LZE22T | Human | Esophagus | ESCC | 6.49e-04 | 3.69e-01 | 0.068 |
| 51734 | MSRB1 | LZE24T | Human | Esophagus | ESCC | 1.86e-19 | 4.15e-01 | 0.0596 |
| 51734 | MSRB1 | LZE6T | Human | Esophagus | ESCC | 1.58e-02 | 1.10e-01 | 0.0845 |
| 51734 | MSRB1 | P1T-E | Human | Esophagus | ESCC | 4.81e-04 | 3.19e-01 | 0.0875 |
| 51734 | MSRB1 | P2T-E | Human | Esophagus | ESCC | 1.91e-27 | 4.62e-01 | 0.1177 |
| 51734 | MSRB1 | P4T-E | Human | Esophagus | ESCC | 7.16e-33 | 7.74e-01 | 0.1323 |
| 51734 | MSRB1 | P5T-E | Human | Esophagus | ESCC | 6.39e-31 | 4.84e-01 | 0.1327 |
| 51734 | MSRB1 | P8T-E | Human | Esophagus | ESCC | 5.28e-15 | 4.41e-01 | 0.0889 |
| 51734 | MSRB1 | P9T-E | Human | Esophagus | ESCC | 1.22e-20 | 4.38e-01 | 0.1131 |
| 51734 | MSRB1 | P10T-E | Human | Esophagus | ESCC | 2.05e-12 | 1.03e-01 | 0.116 |
| 51734 | MSRB1 | P11T-E | Human | Esophagus | ESCC | 2.02e-13 | 7.11e-01 | 0.1426 |
| 51734 | MSRB1 | P12T-E | Human | Esophagus | ESCC | 1.56e-25 | 4.85e-01 | 0.1122 |
| 51734 | MSRB1 | P15T-E | Human | Esophagus | ESCC | 4.93e-37 | 8.09e-01 | 0.1149 |
| 51734 | MSRB1 | P16T-E | Human | Esophagus | ESCC | 2.59e-08 | 1.24e-01 | 0.1153 |
| 51734 | MSRB1 | P17T-E | Human | Esophagus | ESCC | 9.94e-15 | 4.89e-01 | 0.1278 |
| Page: 1 2 3 4 5 6 |
| Transcriptomic changes along malignancy continuum. |
| Tissue | Expression Dynamics | Abbreviation |
| Esophagus |  | ESCC: Esophageal squamous cell carcinoma |
| HGIN: High-grade intraepithelial neoplasias | ||
| LGIN: Low-grade intraepithelial neoplasias | ||
| Liver |  | HCC: Hepatocellular carcinoma |
| NAFLD: Non-alcoholic fatty liver disease | ||
| Oral Cavity |  | EOLP: Erosive Oral lichen planus |
| LP: leukoplakia | ||
| NEOLP: Non-erosive oral lichen planus | ||
| OSCC: Oral squamous cell carcinoma | ||
| Skin |  | AK: Actinic keratosis |
| cSCC: Cutaneous squamous cell carcinoma | ||
| SCCIS:squamous cell carcinoma in situ |
| ∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
| Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
| Figure of enriched GO biological processes. |
| Tissue | Disease Stage | Enriched GO biological Processes |
| Colorectum | AD |  |
| Colorectum | SER |  |
| Colorectum | MSS |  |
| Colorectum | MSI-H |  |
| Colorectum | FAP |  |
| ∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched GO biological processes. |
| GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
| GO:0051258111 | Esophagus | ESCC | protein polymerization | 183/8552 | 297/18723 | 1.94e-08 | 3.75e-07 | 183 |
| GO:000701527 | Esophagus | ESCC | actin filament organization | 259/8552 | 442/18723 | 2.37e-08 | 4.50e-07 | 259 |
| GO:000815420 | Esophagus | ESCC | actin polymerization or depolymerization | 130/8552 | 218/18723 | 2.19e-05 | 1.88e-04 | 130 |
| GO:0030041110 | Esophagus | ESCC | actin filament polymerization | 114/8552 | 191/18723 | 6.46e-05 | 4.92e-04 | 114 |
| GO:000701512 | Liver | Cirrhotic | actin filament organization | 171/4634 | 442/18723 | 3.93e-11 | 2.30e-09 | 171 |
| GO:005125812 | Liver | Cirrhotic | protein polymerization | 116/4634 | 297/18723 | 2.87e-08 | 9.78e-07 | 116 |
| GO:000815412 | Liver | Cirrhotic | actin polymerization or depolymerization | 86/4634 | 218/18723 | 1.04e-06 | 2.13e-05 | 86 |
| GO:003004112 | Liver | Cirrhotic | actin filament polymerization | 77/4634 | 191/18723 | 1.41e-06 | 2.79e-05 | 77 |
| GO:005125822 | Liver | HCC | protein polymerization | 182/7958 | 297/18723 | 4.17e-11 | 1.58e-09 | 182 |
| GO:000701522 | Liver | HCC | actin filament organization | 252/7958 | 442/18723 | 3.83e-10 | 1.25e-08 | 252 |
| GO:000815422 | Liver | HCC | actin polymerization or depolymerization | 130/7958 | 218/18723 | 2.31e-07 | 4.14e-06 | 130 |
| GO:003004122 | Liver | HCC | actin filament polymerization | 116/7958 | 191/18723 | 2.66e-07 | 4.68e-06 | 116 |
| GO:005125820 | Oral cavity | OSCC | protein polymerization | 169/7305 | 297/18723 | 2.57e-10 | 7.17e-09 | 169 |
| GO:000701520 | Oral cavity | OSCC | actin filament organization | 230/7305 | 442/18723 | 1.37e-08 | 2.77e-07 | 230 |
| GO:000815418 | Oral cavity | OSCC | actin polymerization or depolymerization | 117/7305 | 218/18723 | 7.38e-06 | 8.04e-05 | 117 |
| GO:003004118 | Oral cavity | OSCC | actin filament polymerization | 103/7305 | 191/18723 | 1.94e-05 | 1.87e-04 | 103 |
| GO:0051258110 | Oral cavity | LP | protein polymerization | 113/4623 | 297/18723 | 1.90e-07 | 5.92e-06 | 113 |
| GO:0007015110 | Oral cavity | LP | actin filament organization | 143/4623 | 442/18723 | 1.44e-04 | 1.65e-03 | 143 |
| GO:003004119 | Oral cavity | LP | actin filament polymerization | 69/4623 | 191/18723 | 2.65e-04 | 2.75e-03 | 69 |
| GO:000815419 | Oral cavity | LP | actin polymerization or depolymerization | 76/4623 | 218/18723 | 4.67e-04 | 4.42e-03 | 76 |
| Page: 1 2 |
| Enriched KEGG pathways. |
| Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
| Page: 1 |
Top |
Cell-cell communication analysis |
| Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
| Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
| Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
| Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
| TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
| ∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
| Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
| Annotation of somatic variants for genes involved in malignant transformation |
| Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
| MSRB1 | insertion | Frame_Shift_Ins | novel | c.294_295insTGTCTCAACCTCCCAAAGTGCCGGGATTATAGGCGTG | p.Ser99CysfsTer? | p.S99Cfs*? | Q9NZV6 | protein_coding | TCGA-A8-A07R-01 | Breast | breast invasive carcinoma | Female | >=65 | III/IV | Ancillary | zoledronic | SD | ||
| MSRB1 | SNV | Missense_Mutation | rs748260206 | c.278N>A | p.Arg93Gln | p.R93Q | Q9NZV6 | protein_coding | deleterious(0) | possibly_damaging(0.801) | TCGA-D5-6540-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
| MSRB1 | SNV | Missense_Mutation | rs760850788 | c.173N>A | p.Arg58His | p.R58H | Q9NZV6 | protein_coding | tolerated(0.6) | benign(0) | TCGA-EI-6882-01 | Colorectum | rectum adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | SD |
| MSRB1 | SNV | Missense_Mutation | rs373673022 | c.119C>T | p.Ser40Leu | p.S40L | Q9NZV6 | protein_coding | tolerated(0.06) | probably_damaging(0.931) | TCGA-A5-A1OH-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | III/IV | Chemotherapy | carboplatin | CR |
| MSRB1 | SNV | Missense_Mutation | rs755400235 | c.58N>A | p.Val20Ile | p.V20I | Q9NZV6 | protein_coding | tolerated(1) | benign(0) | TCGA-AP-A0LM-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Chemotherapy | cisplatin | SD |
| MSRB1 | SNV | Missense_Mutation | c.335N>T | p.Ala112Val | p.A112V | Q9NZV6 | protein_coding | tolerated(0.28) | benign(0) | TCGA-B5-A11U-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | III/IV | Unknown | Unknown | SD | |
| MSRB1 | SNV | Missense_Mutation | rs770241137 | c.188G>T | p.Arg63Ile | p.R63I | Q9NZV6 | protein_coding | deleterious(0.01) | benign(0.214) | TCGA-BK-A6W3-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
| MSRB1 | SNV | Missense_Mutation | novel | c.191N>T | p.Ser64Phe | p.S64F | Q9NZV6 | protein_coding | deleterious(0.01) | benign(0.049) | TCGA-FI-A2D0-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
| MSRB1 | SNV | Missense_Mutation | novel | c.314N>G | p.Pro105Arg | p.P105R | Q9NZV6 | protein_coding | deleterious(0) | possibly_damaging(0.863) | TCGA-XR-A8TF-01 | Liver | liver hepatocellular carcinoma | Male | >=65 | I/II | Unknown | Unknown | PD |
| MSRB1 | deletion | Frame_Shift_Del | novel | c.15_39delCTTCTTCGGGGGCGAGGTTTTCCAG | p.Ser5ArgfsTer55 | p.S5Rfs*55 | Q9NZV6 | protein_coding | TCGA-G3-A5SK-01 | Liver | liver hepatocellular carcinoma | Male | <65 | I/II | Unknown | Unknown | PD |
| Page: 1 2 |
Top |
Related drugs of malignant transformation related genes |
| Identification of chemicals and drugs interact with genes involved in malignant transfromation |
| (DGIdb 4.0) |
| Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
| Page: 1 |
Copyright 2023-Present -The University of Texas Health Science Center at Houston |