|
Gene: MRPL46 |
Gene summary for MRPL46 |
Gene summary. |
Gene information | Species | Human | Gene symbol | MRPL46 | Gene ID | 26589 |
Gene name | mitochondrial ribosomal protein L46 | |
Gene Alias | C15orf4 | |
Cytomap | 15q25.3 | |
Gene Type | protein-coding | GO ID | GO:0008150 | UniProtAcc | Q9H2W6 |
Top |
Malignant transformation analysis |
Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
Malignant transformation involving gene list. |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
26589 | MRPL46 | LZE4T | Human | Esophagus | ESCC | 4.53e-15 | 2.17e-01 | 0.0811 |
26589 | MRPL46 | LZE7T | Human | Esophagus | ESCC | 5.15e-10 | 4.48e-01 | 0.0667 |
26589 | MRPL46 | LZE8T | Human | Esophagus | ESCC | 9.15e-05 | 2.14e-01 | 0.067 |
26589 | MRPL46 | LZE20T | Human | Esophagus | ESCC | 2.43e-03 | 1.03e-01 | 0.0662 |
26589 | MRPL46 | LZE24T | Human | Esophagus | ESCC | 1.63e-15 | 2.19e-01 | 0.0596 |
26589 | MRPL46 | LZE21T | Human | Esophagus | ESCC | 2.38e-03 | 2.50e-01 | 0.0655 |
26589 | MRPL46 | LZE6T | Human | Esophagus | ESCC | 4.95e-06 | 2.39e-01 | 0.0845 |
26589 | MRPL46 | P1T-E | Human | Esophagus | ESCC | 4.86e-11 | 3.43e-01 | 0.0875 |
26589 | MRPL46 | P2T-E | Human | Esophagus | ESCC | 3.39e-19 | 3.57e-01 | 0.1177 |
26589 | MRPL46 | P4T-E | Human | Esophagus | ESCC | 1.25e-33 | 7.86e-01 | 0.1323 |
26589 | MRPL46 | P5T-E | Human | Esophagus | ESCC | 1.05e-14 | 2.73e-01 | 0.1327 |
26589 | MRPL46 | P8T-E | Human | Esophagus | ESCC | 2.66e-24 | 4.78e-01 | 0.0889 |
26589 | MRPL46 | P9T-E | Human | Esophagus | ESCC | 2.22e-16 | 3.74e-01 | 0.1131 |
26589 | MRPL46 | P10T-E | Human | Esophagus | ESCC | 1.01e-27 | 4.38e-01 | 0.116 |
26589 | MRPL46 | P11T-E | Human | Esophagus | ESCC | 4.17e-09 | 3.03e-01 | 0.1426 |
26589 | MRPL46 | P12T-E | Human | Esophagus | ESCC | 1.88e-35 | 6.82e-01 | 0.1122 |
26589 | MRPL46 | P15T-E | Human | Esophagus | ESCC | 7.35e-31 | 6.02e-01 | 0.1149 |
26589 | MRPL46 | P16T-E | Human | Esophagus | ESCC | 3.59e-29 | 5.33e-01 | 0.1153 |
26589 | MRPL46 | P17T-E | Human | Esophagus | ESCC | 8.89e-05 | 3.00e-01 | 0.1278 |
26589 | MRPL46 | P19T-E | Human | Esophagus | ESCC | 4.56e-10 | 6.01e-01 | 0.1662 |
Page: 1 2 3 4 5 6 |
Transcriptomic changes along malignancy continuum. |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
Figure of enriched GO biological processes. |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | |
Colorectum | SER | |
Colorectum | MSS | |
Colorectum | MSI-H | |
Colorectum | FAP |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
Enriched GO biological processes. |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
Enriched KEGG pathways. |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
Annotation of somatic variants for genes involved in malignant transformation |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
MRPL46 | SNV | Missense_Mutation | novel | c.833N>C | p.Asp278Ala | p.D278A | Q9H2W6 | protein_coding | deleterious(0) | possibly_damaging(0.696) | TCGA-D8-A1XK-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicine+cyclophosphamide | SD |
MRPL46 | SNV | Missense_Mutation | novel | c.359T>C | p.Leu120Ser | p.L120S | Q9H2W6 | protein_coding | deleterious(0) | possibly_damaging(0.783) | TCGA-E9-A6HE-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | adriamycin | CR |
MRPL46 | deletion | Frame_Shift_Del | c.730delT | p.Ser244ProfsTer21 | p.S244Pfs*21 | Q9H2W6 | protein_coding | TCGA-AR-A0TZ-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Unspecific | Doxorubicin | PD | |||
MRPL46 | insertion | Frame_Shift_Ins | novel | c.33_37dupGGTGG | p.Ala13GlyfsTer17 | p.A13Gfs*17 | Q9H2W6 | protein_coding | TCGA-BH-A0HF-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | arimidex | SD | ||
MRPL46 | deletion | In_Frame_Del | c.687_707delCAAGGTGTTCTTCTTCAAAGC | p.Lys230_Ala236del | p.K230_A236del | Q9H2W6 | protein_coding | TCGA-C8-A1HJ-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |||
MRPL46 | SNV | Missense_Mutation | c.707C>A | p.Ala236Glu | p.A236E | Q9H2W6 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-AA-3672-01 | Colorectum | colon adenocarcinoma | Female | >=65 | III/IV | Unknown | Unknown | SD | |
MRPL46 | SNV | Missense_Mutation | rs199889183 | c.269G>A | p.Arg90His | p.R90H | Q9H2W6 | protein_coding | deleterious(0) | probably_damaging(0.938) | TCGA-AA-A010-01 | Colorectum | colon adenocarcinoma | Female | <65 | I/II | Chemotherapy | folinic | CR |
MRPL46 | SNV | Missense_Mutation | c.605C>G | p.Ala202Gly | p.A202G | Q9H2W6 | protein_coding | deleterious(0.03) | probably_damaging(0.975) | TCGA-AA-A01C-01 | Colorectum | colon adenocarcinoma | Male | >=65 | III/IV | Unknown | Unknown | SD | |
MRPL46 | SNV | Missense_Mutation | rs755678536 | c.407N>A | p.Arg136His | p.R136H | Q9H2W6 | protein_coding | deleterious(0) | probably_damaging(0.995) | TCGA-A5-A0G2-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
MRPL46 | SNV | Missense_Mutation | novel | c.262N>A | p.Glu88Lys | p.E88K | Q9H2W6 | protein_coding | deleterious(0) | probably_damaging(1) | TCGA-A5-A0G2-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
Page: 1 2 3 |
Top |
Related drugs of malignant transformation related genes |
Identification of chemicals and drugs interact with genes involved in malignant transfromation |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |