|
|||||
|
 | |
| |
| |
| |
| |
| |
|
Gene: HIST1H2AG |
Gene summary for HIST1H2AG |
 Gene summary. |
| Gene information | Species | Human | Gene symbol | HIST1H2AG | Gene ID | 8969 |
| Gene name | H2A clustered histone 11 | |
| Gene Alias | H2A.1b | |
| Cytomap | 6p22.1 | |
| Gene Type | protein-coding | GO ID | GO:0008150 | UniProtAcc | A4FTV9 |
Top |
Malignant transformation analysis |
| Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
| Malignant transformation involving gene list. |
| Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
| 8969 | HIST1H2AG | LZE4T | Human | Esophagus | ESCC | 2.11e-06 | 3.79e-01 | 0.0811 |
| 8969 | HIST1H2AG | LZE7T | Human | Esophagus | ESCC | 1.44e-05 | 5.04e-01 | 0.0667 |
| 8969 | HIST1H2AG | LZE20T | Human | Esophagus | ESCC | 3.42e-04 | 2.38e-01 | 0.0662 |
| 8969 | HIST1H2AG | LZE21D1 | Human | Esophagus | HGIN | 1.95e-06 | 9.77e-01 | 0.0632 |
| 8969 | HIST1H2AG | LZE22T | Human | Esophagus | ESCC | 1.60e-06 | 5.37e-01 | 0.068 |
| 8969 | HIST1H2AG | LZE24T | Human | Esophagus | ESCC | 7.63e-11 | 3.47e-01 | 0.0596 |
| 8969 | HIST1H2AG | LZE21T | Human | Esophagus | ESCC | 6.54e-14 | 8.21e-01 | 0.0655 |
| 8969 | HIST1H2AG | LZE6T | Human | Esophagus | ESCC | 2.78e-06 | 5.40e-01 | 0.0845 |
| 8969 | HIST1H2AG | P1T-E | Human | Esophagus | ESCC | 7.90e-27 | 1.84e+00 | 0.0875 |
| 8969 | HIST1H2AG | P2T-E | Human | Esophagus | ESCC | 5.68e-24 | 4.80e-01 | 0.1177 |
| 8969 | HIST1H2AG | P4T-E | Human | Esophagus | ESCC | 6.71e-14 | 3.32e-01 | 0.1323 |
| 8969 | HIST1H2AG | P5T-E | Human | Esophagus | ESCC | 2.31e-02 | 1.64e-01 | 0.1327 |
| 8969 | HIST1H2AG | P8T-E | Human | Esophagus | ESCC | 4.54e-06 | 1.77e-01 | 0.0889 |
| 8969 | HIST1H2AG | P10T-E | Human | Esophagus | ESCC | 1.18e-06 | 2.18e-01 | 0.116 |
| 8969 | HIST1H2AG | P11T-E | Human | Esophagus | ESCC | 1.66e-02 | 2.50e-01 | 0.1426 |
| 8969 | HIST1H2AG | P12T-E | Human | Esophagus | ESCC | 3.02e-26 | 4.88e-01 | 0.1122 |
| 8969 | HIST1H2AG | P15T-E | Human | Esophagus | ESCC | 1.15e-05 | 1.84e-01 | 0.1149 |
| 8969 | HIST1H2AG | P16T-E | Human | Esophagus | ESCC | 4.28e-05 | 1.79e-01 | 0.1153 |
| 8969 | HIST1H2AG | P20T-E | Human | Esophagus | ESCC | 9.61e-29 | 7.55e-01 | 0.1124 |
| 8969 | HIST1H2AG | P21T-E | Human | Esophagus | ESCC | 2.28e-04 | 1.29e-01 | 0.1617 |
| Page: 1 2 3 |
| Transcriptomic changes along malignancy continuum. |
| Tissue | Expression Dynamics | Abbreviation |
| Esophagus |  | ESCC: Esophageal squamous cell carcinoma |
| HGIN: High-grade intraepithelial neoplasias | ||
| LGIN: Low-grade intraepithelial neoplasias |
| ∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
| Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
| Figure of enriched GO biological processes. |
| Tissue | Disease Stage | Enriched GO biological Processes |
| Colorectum | AD |  |
| Colorectum | SER |  |
| Colorectum | MSS |  |
| Colorectum | MSI-H |  |
| Colorectum | FAP |  |
| ∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched GO biological processes. |
| GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
| Page: 1 |
| Enriched KEGG pathways. |
| Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
| Page: 1 |
Top |
Cell-cell communication analysis |
| Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
| Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
| Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
| Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
| TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
| ∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
| Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
| Annotation of somatic variants for genes involved in malignant transformation |
| Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
| HIST1H2AG | SNV | Missense_Mutation | c.17A>G | p.Lys6Arg | p.K6R | P0C0S8 | protein_coding | deleterious_low_confidence(0.01) | benign(0.143) | TCGA-BH-A0B0-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | CR | |
| HIST1H2AG | deletion | Frame_Shift_Del | c.127_148delCGGGTCGGGGCCGGCGCGCCGG | p.Arg43CysfsTer10 | p.R43Cfs*10 | P0C0S8 | protein_coding | TCGA-A8-A09M-01 | Breast | breast invasive carcinoma | Female | >=65 | III/IV | Chemotherapy | paclitaxel | CR | |||
| HIST1H2AG | SNV | Missense_Mutation | novel | c.184N>A | p.Glu62Lys | p.E62K | P0C0S8 | protein_coding | deleterious_low_confidence(0.01) | possibly_damaging(0.79) | TCGA-VS-A959-01 | Cervix | cervical & endocervical cancer | Female | >=65 | I/II | Unknown | Unknown | SD |
| HIST1H2AG | SNV | Missense_Mutation | c.116A>G | p.Asn39Ser | p.N39S | P0C0S8 | protein_coding | tolerated_low_confidence(0.06) | benign(0.137) | TCGA-A6-4105-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | PD | |
| HIST1H2AG | deletion | Frame_Shift_Del | c.355delN | p.Lys120ArgfsTer16 | p.K120Rfs*16 | P0C0S8 | protein_coding | TCGA-D5-6928-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD | |||
| HIST1H2AG | SNV | Missense_Mutation | novel | c.175N>A | p.Leu59Met | p.L59M | P0C0S8 | protein_coding | deleterious_low_confidence(0) | probably_damaging(0.928) | TCGA-AP-A1DK-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
| HIST1H2AG | SNV | Missense_Mutation | novel | c.353N>A | p.Pro118His | p.P118H | P0C0S8 | protein_coding | deleterious_low_confidence(0) | probably_damaging(0.991) | TCGA-AP-A1DK-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
| HIST1H2AG | SNV | Missense_Mutation | rs765198765 | c.121N>A | p.Ala41Thr | p.A41T | P0C0S8 | protein_coding | deleterious_low_confidence(0.01) | probably_damaging(0.96) | TCGA-AX-A2IO-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Chemotherapy | carboplatin | SD |
| HIST1H2AG | SNV | Missense_Mutation | c.247N>A | p.His83Asn | p.H83N | P0C0S8 | protein_coding | deleterious_low_confidence(0.01) | probably_damaging(0.997) | TCGA-B5-A0JY-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Chemotherapy | doxorubicin | SD | |
| HIST1H2AG | SNV | Missense_Mutation | c.350N>C | p.Leu117Pro | p.L117P | P0C0S8 | protein_coding | deleterious_low_confidence(0.01) | probably_damaging(0.949) | TCGA-B5-A0K9-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
| Page: 1 2 3 |
Top |
Related drugs of malignant transformation related genes |
| Identification of chemicals and drugs interact with genes involved in malignant transfromation |
| (DGIdb 4.0) |
| Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
| Page: 1 |
Copyright 2023-Present -The University of Texas Health Science Center at Houston |