|
|||||
|
 | |
| |
| |
| |
| |
| |
|
Gene: DLGAP5 |
Gene summary for DLGAP5 |
 Gene summary. |
| Gene information | Species | Human | Gene symbol | DLGAP5 | Gene ID | 9787 |
| Gene name | DLG associated protein 5 | |
| Gene Alias | DLG7 | |
| Cytomap | 14q22.3 | |
| Gene Type | protein-coding | GO ID | GO:0000070 | UniProtAcc | Q15398 |
Top |
Malignant transformation analysis |
| Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
| Malignant transformation involving gene list. |
| Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
| 9787 | DLGAP5 | P2T-E | Human | Esophagus | ESCC | 4.17e-05 | 2.95e-01 | 0.1177 |
| 9787 | DLGAP5 | P4T-E | Human | Esophagus | ESCC | 3.48e-08 | 3.22e-01 | 0.1323 |
| 9787 | DLGAP5 | P5T-E | Human | Esophagus | ESCC | 4.41e-07 | 1.91e-01 | 0.1327 |
| 9787 | DLGAP5 | P9T-E | Human | Esophagus | ESCC | 1.11e-03 | 1.56e-01 | 0.1131 |
| 9787 | DLGAP5 | P10T-E | Human | Esophagus | ESCC | 8.84e-05 | 2.60e-01 | 0.116 |
| 9787 | DLGAP5 | P15T-E | Human | Esophagus | ESCC | 3.38e-04 | 3.10e-01 | 0.1149 |
| 9787 | DLGAP5 | P17T-E | Human | Esophagus | ESCC | 8.50e-05 | 4.01e-01 | 0.1278 |
| 9787 | DLGAP5 | P19T-E | Human | Esophagus | ESCC | 5.57e-05 | 5.72e-01 | 0.1662 |
| 9787 | DLGAP5 | P20T-E | Human | Esophagus | ESCC | 1.51e-02 | 1.78e-01 | 0.1124 |
| 9787 | DLGAP5 | P21T-E | Human | Esophagus | ESCC | 4.31e-06 | 2.54e-01 | 0.1617 |
| 9787 | DLGAP5 | P24T-E | Human | Esophagus | ESCC | 3.60e-13 | 4.44e-01 | 0.1287 |
| 9787 | DLGAP5 | P26T-E | Human | Esophagus | ESCC | 1.88e-04 | 2.85e-01 | 0.1276 |
| 9787 | DLGAP5 | P28T-E | Human | Esophagus | ESCC | 3.50e-02 | 9.61e-02 | 0.1149 |
| 9787 | DLGAP5 | P30T-E | Human | Esophagus | ESCC | 1.02e-02 | 3.43e-01 | 0.137 |
| 9787 | DLGAP5 | P31T-E | Human | Esophagus | ESCC | 1.96e-05 | 2.52e-01 | 0.1251 |
| 9787 | DLGAP5 | P32T-E | Human | Esophagus | ESCC | 4.12e-11 | 2.93e-01 | 0.1666 |
| 9787 | DLGAP5 | P36T-E | Human | Esophagus | ESCC | 2.11e-03 | 2.27e-01 | 0.1187 |
| 9787 | DLGAP5 | P37T-E | Human | Esophagus | ESCC | 4.26e-12 | 5.49e-01 | 0.1371 |
| 9787 | DLGAP5 | P38T-E | Human | Esophagus | ESCC | 1.30e-06 | 4.85e-01 | 0.127 |
| 9787 | DLGAP5 | P42T-E | Human | Esophagus | ESCC | 2.93e-03 | 2.26e-01 | 0.1175 |
| Page: 1 2 3 |
| Transcriptomic changes along malignancy continuum. |
| Tissue | Expression Dynamics | Abbreviation |
| Esophagus |  | ESCC: Esophageal squamous cell carcinoma |
| HGIN: High-grade intraepithelial neoplasias | ||
| LGIN: Low-grade intraepithelial neoplasias | ||
| Oral Cavity |  | EOLP: Erosive Oral lichen planus |
| LP: leukoplakia | ||
| NEOLP: Non-erosive oral lichen planus | ||
| OSCC: Oral squamous cell carcinoma | ||
| Skin |  | AK: Actinic keratosis |
| cSCC: Cutaneous squamous cell carcinoma | ||
| SCCIS:squamous cell carcinoma in situ | ||
| Thyroid |  | ATC: Anaplastic thyroid cancer |
| HT: Hashimoto's thyroiditis | ||
| PTC: Papillary thyroid cancer |
| ∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
| Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
| Figure of enriched GO biological processes. |
| Tissue | Disease Stage | Enriched GO biological Processes |
| Colorectum | AD |  |
| Colorectum | SER |  |
| Colorectum | MSS |  |
| Colorectum | MSI-H |  |
| Colorectum | FAP |  |
| ∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched GO biological processes. |
| GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
| GO:014001414 | Esophagus | ESCC | mitotic nuclear division | 218/8552 | 287/18723 | 6.17e-26 | 1.78e-23 | 218 |
| GO:005165617 | Esophagus | ESCC | establishment of organelle localization | 273/8552 | 390/18723 | 9.13e-23 | 1.81e-20 | 273 |
| GO:000007011 | Esophagus | ESCC | mitotic sister chromatid segregation | 138/8552 | 168/18723 | 1.37e-22 | 2.63e-20 | 138 |
| GO:00008194 | Esophagus | ESCC | sister chromatid segregation | 157/8552 | 202/18723 | 8.41e-21 | 1.33e-18 | 157 |
| GO:003304416 | Esophagus | ESCC | regulation of chromosome organization | 145/8552 | 187/18723 | 3.80e-19 | 4.31e-17 | 145 |
| GO:000705911 | Esophagus | ESCC | chromosome segregation | 238/8552 | 346/18723 | 1.72e-18 | 1.82e-16 | 238 |
| GO:004477216 | Esophagus | ESCC | mitotic cell cycle phase transition | 281/8552 | 424/18723 | 4.63e-18 | 4.45e-16 | 281 |
| GO:190285015 | Esophagus | ESCC | microtubule cytoskeleton organization involved in mitosis | 116/8552 | 147/18723 | 1.25e-16 | 9.91e-15 | 116 |
| GO:000734615 | Esophagus | ESCC | regulation of mitotic cell cycle | 293/8552 | 457/18723 | 8.00e-16 | 5.64e-14 | 293 |
| GO:000705214 | Esophagus | ESCC | mitotic spindle organization | 97/8552 | 120/18723 | 2.17e-15 | 1.33e-13 | 97 |
| GO:000705114 | Esophagus | ESCC | spindle organization | 134/8552 | 184/18723 | 5.70e-14 | 2.87e-12 | 134 |
| GO:00482853 | Esophagus | ESCC | organelle fission | 301/8552 | 488/18723 | 4.64e-13 | 2.12e-11 | 301 |
| GO:00988133 | Esophagus | ESCC | nuclear chromosome segregation | 187/8552 | 281/18723 | 1.00e-12 | 4.36e-11 | 187 |
| GO:005130311 | Esophagus | ESCC | establishment of chromosome localization | 67/8552 | 80/18723 | 1.92e-12 | 8.09e-11 | 67 |
| GO:005000011 | Esophagus | ESCC | chromosome localization | 68/8552 | 82/18723 | 3.37e-12 | 1.32e-10 | 68 |
| GO:00002802 | Esophagus | ESCC | nuclear division | 270/8552 | 439/18723 | 1.17e-11 | 4.24e-10 | 270 |
| GO:190198713 | Esophagus | ESCC | regulation of cell cycle phase transition | 242/8552 | 390/18723 | 3.86e-11 | 1.26e-09 | 242 |
| GO:190199013 | Esophagus | ESCC | regulation of mitotic cell cycle phase transition | 191/8552 | 299/18723 | 1.35e-10 | 3.94e-09 | 191 |
| GO:004578710 | Esophagus | ESCC | positive regulation of cell cycle | 196/8552 | 313/18723 | 9.27e-10 | 2.24e-08 | 196 |
| GO:00519833 | Esophagus | ESCC | regulation of chromosome segregation | 67/8552 | 91/18723 | 5.42e-08 | 9.66e-07 | 67 |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched KEGG pathways. |
| Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
| Page: 1 |
Top |
Cell-cell communication analysis |
| Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
| Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
| Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
| Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
| TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
| ∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
| Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
| Annotation of somatic variants for genes involved in malignant transformation |
| Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
| DLGAP5 | SNV | Missense_Mutation | novel | c.1922N>C | p.Lys641Thr | p.K641T | Q15398 | protein_coding | tolerated(0.2) | benign(0.003) | TCGA-AN-A046-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
| DLGAP5 | SNV | Missense_Mutation | c.992N>A | p.Arg331Lys | p.R331K | Q15398 | protein_coding | tolerated(0.07) | benign(0.151) | TCGA-D8-A1JA-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | adriamycin | PD | |
| DLGAP5 | SNV | Missense_Mutation | c.1978N>G | p.Thr660Ala | p.T660A | Q15398 | protein_coding | tolerated(0.61) | benign(0.007) | TCGA-E2-A1LL-01 | Breast | breast invasive carcinoma | Female | >=65 | III/IV | Chemotherapy | docetaxel | PD | |
| DLGAP5 | deletion | Frame_Shift_Del | c.124_160delAATAGACACTTTGGTTTGAAAGATGTAAACATTCCAA | p.Asn42ProfsTer10 | p.N42Pfs*10 | Q15398 | protein_coding | TCGA-A1-A0SO-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | SD | ||||
| DLGAP5 | deletion | Frame_Shift_Del | novel | c.1773delN | p.Glu591AspfsTer9 | p.E591Dfs*9 | Q15398 | protein_coding | TCGA-EW-A2FV-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | docetaxel | SD | ||
| DLGAP5 | deletion | Frame_Shift_Del | novel | c.1519delN | p.Asp507MetfsTer11 | p.D507Mfs*11 | Q15398 | protein_coding | TCGA-EW-A2FV-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | docetaxel | SD | ||
| DLGAP5 | SNV | Missense_Mutation | c.326N>G | p.Gln109Arg | p.Q109R | Q15398 | protein_coding | deleterious(0) | probably_damaging(0.909) | TCGA-C5-A3HL-01 | Cervix | cervical & endocervical cancer | Female | >=65 | I/II | Unknown | Unknown | SD | |
| DLGAP5 | SNV | Missense_Mutation | c.1045N>A | p.Glu349Lys | p.E349K | Q15398 | protein_coding | tolerated(0.1) | benign(0.173) | TCGA-LP-A4AV-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD | |
| DLGAP5 | SNV | Missense_Mutation | novel | c.673N>T | p.Ala225Ser | p.A225S | Q15398 | protein_coding | tolerated(0.28) | benign(0.003) | TCGA-MA-AA3W-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
| DLGAP5 | SNV | Missense_Mutation | novel | c.322G>C | p.Glu108Gln | p.E108Q | Q15398 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-VS-A9UZ-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD |
| Page: 1 2 3 4 5 6 7 8 |
Top |
Related drugs of malignant transformation related genes |
| Identification of chemicals and drugs interact with genes involved in malignant transfromation |
| (DGIdb 4.0) |
| Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
| Page: 1 |
Copyright 2023-Present -The University of Texas Health Science Center at Houston |