|
Gene: COL21A1 |
Gene summary for COL21A1 |
Gene summary. |
Gene information | Species | Human | Gene symbol | COL21A1 | Gene ID | 81578 |
Gene name | collagen type XXI alpha 1 chain | |
Gene Alias | COLA1L | |
Cytomap | 6p12.1 | |
Gene Type | protein-coding | GO ID | GO:0005575 | UniProtAcc | A0A158RFW1 |
Top |
Malignant transformation analysis |
Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
Malignant transformation involving gene list. |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
81578 | COL21A1 | HCC1_Meng | Human | Liver | HCC | 1.18e-05 | 2.13e-02 | 0.0246 |
81578 | COL21A1 | S014 | Human | Liver | HCC | 2.66e-21 | 8.21e-01 | 0.2254 |
81578 | COL21A1 | S015 | Human | Liver | HCC | 8.47e-13 | 8.57e-01 | 0.2375 |
81578 | COL21A1 | S016 | Human | Liver | HCC | 3.30e-41 | 1.45e+00 | 0.2243 |
81578 | COL21A1 | RNA-P17T-P17T-4 | Human | Lung | IAC | 4.71e-02 | 4.56e-01 | 0.343 |
81578 | COL21A1 | RNA-P18T-P18T-8 | Human | Lung | IAC | 1.25e-04 | 1.08e+00 | 0.1151 |
81578 | COL21A1 | RNA-P6T2-P6T2-1 | Human | Lung | IAC | 2.50e-08 | 3.55e-01 | -0.0166 |
81578 | COL21A1 | RNA-P6T2-P6T2-2 | Human | Lung | IAC | 1.48e-12 | 4.21e-01 | -0.0132 |
81578 | COL21A1 | RNA-P6T2-P6T2-3 | Human | Lung | IAC | 5.28e-10 | 3.87e-01 | -0.013 |
81578 | COL21A1 | RNA-P6T2-P6T2-4 | Human | Lung | IAC | 1.47e-07 | 3.46e-01 | -0.0121 |
81578 | COL21A1 | RNA-P7T1-P7T1-1 | Human | Lung | AIS | 3.94e-06 | 5.71e-01 | -0.0961 |
81578 | COL21A1 | RNA-P7T1-P7T1-2 | Human | Lung | AIS | 2.28e-04 | 4.38e-01 | -0.0876 |
81578 | COL21A1 | ATC13 | Human | Thyroid | ATC | 1.76e-41 | 9.83e-01 | 0.34 |
81578 | COL21A1 | ATC5 | Human | Thyroid | ATC | 5.12e-38 | 1.05e+00 | 0.34 |
Page: 1 |
Transcriptomic changes along malignancy continuum. |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
Figure of enriched GO biological processes. |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | |
Colorectum | SER | |
Colorectum | MSS | |
Colorectum | MSI-H | |
Colorectum | FAP |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
Enriched GO biological processes. |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
Enriched KEGG pathways. |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
Annotation of somatic variants for genes involved in malignant transformation |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
COL21A1 | SNV | Missense_Mutation | c.1181N>C | p.Gly394Ala | p.G394A | Q96P44 | protein_coding | tolerated(0.17) | benign(0.015) | TCGA-A1-A0SO-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | SD | ||
COL21A1 | SNV | Missense_Mutation | c.116N>C | p.Val39Ala | p.V39A | Q96P44 | protein_coding | deleterious(0.05) | probably_damaging(0.994) | TCGA-A8-A075-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | epirubicin | CR | |
COL21A1 | insertion | Frame_Shift_Ins | novel | c.2163_2164insCCCCTCAAGGCTGCACAAAGGATGAGTCACATTG | p.Gly722ProfsTer28 | p.G722Pfs*28 | Q96P44 | protein_coding | TCGA-AN-A0G0-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
COL21A1 | deletion | Frame_Shift_Del | c.235_254delGTTCAATATAGTGACTACCC | p.Val79CysfsTer10 | p.V79Cfs*10 | Q96P44 | protein_coding | TCGA-BH-A1FN-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD | |||
COL21A1 | deletion | Frame_Shift_Del | novel | c.131delN | p.Gly44AlafsTer12 | p.G44Afs*12 | Q96P44 | protein_coding | TCGA-EW-A2FV-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | docetaxel | SD | ||
COL21A1 | SNV | Missense_Mutation | novel | c.1531N>A | p.Asp511Asn | p.D511N | Q96P44 | protein_coding | tolerated(0.17) | possibly_damaging(0.671) | TCGA-C5-A1MN-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | SD |
COL21A1 | SNV | Missense_Mutation | c.859N>G | p.Gln287Glu | p.Q287E | Q96P44 | protein_coding | deleterious(0.01) | benign(0.388) | TCGA-EK-A3GM-01 | Cervix | cervical & endocervical cancer | Female | >=65 | I/II | Unknown | Unknown | SD | |
COL21A1 | SNV | Missense_Mutation | c.22C>G | p.Leu8Val | p.L8V | Q96P44 | protein_coding | tolerated(0.28) | benign(0.055) | TCGA-LP-A4AV-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD | |
COL21A1 | SNV | Missense_Mutation | novel | c.871N>A | p.Val291Ile | p.V291I | Q96P44 | protein_coding | tolerated(0.38) | benign(0.031) | TCGA-VS-A953-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | PD |
COL21A1 | SNV | Missense_Mutation | c.737N>T | p.Arg246Ile | p.R246I | Q96P44 | protein_coding | deleterious(0.01) | probably_damaging(0.991) | TCGA-A6-6141-01 | Colorectum | colon adenocarcinoma | Male | <65 | I/II | Chemotherapy | 5-fu | SD |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 |
Top |
Related drugs of malignant transformation related genes |
Identification of chemicals and drugs interact with genes involved in malignant transfromation |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |