![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: CDH18 |
Gene summary for CDH18 |
![]() |
Gene information | Species | Human | Gene symbol | CDH18 | Gene ID | 1016 |
Gene name | cadherin 18 | |
Gene Alias | CDH14 | |
Cytomap | 5p14.3 | |
Gene Type | protein-coding | GO ID | GO:0000902 | UniProtAcc | Q13634 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
1016 | CDH18 | HTA11_696_2000001011 | Human | Colorectum | AD | 1.07e-06 | 1.87e-01 | -0.1464 |
1016 | CDH18 | HTA11_866_2000001011 | Human | Colorectum | AD | 5.45e-03 | 1.04e-01 | -0.1001 |
1016 | CDH18 | HTA11_1391_2000001011 | Human | Colorectum | AD | 5.77e-03 | 1.93e-01 | -0.059 |
1016 | CDH18 | HTA11_9408_2000001011 | Human | Colorectum | AD | 9.43e-18 | 1.03e+00 | 0.0451 |
1016 | CDH18 | HTA11_6801_2000001011 | Human | Colorectum | SER | 3.73e-10 | 6.54e-01 | 0.0171 |
1016 | CDH18 | HTA11_99999971662_82457 | Human | Colorectum | MSS | 7.46e-19 | 5.25e-01 | 0.3859 |
1016 | CDH18 | HTA11_99999973899_84307 | Human | Colorectum | MSS | 5.90e-18 | 9.18e-01 | 0.2585 |
1016 | CDH18 | HTA11_99999974143_84620 | Human | Colorectum | MSS | 1.74e-94 | 1.97e+00 | 0.3005 |
Page: 1 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:0045216 | Colorectum | AD | cell-cell junction organization | 80/3918 | 200/18723 | 5.57e-10 | 4.58e-08 | 80 |
GO:0034329 | Colorectum | AD | cell junction assembly | 136/3918 | 420/18723 | 2.02e-08 | 1.15e-06 | 136 |
GO:0007043 | Colorectum | AD | cell-cell junction assembly | 57/3918 | 146/18723 | 4.18e-07 | 1.61e-05 | 57 |
GO:0034332 | Colorectum | AD | adherens junction organization | 20/3918 | 49/18723 | 1.23e-03 | 1.09e-02 | 20 |
GO:00452161 | Colorectum | SER | cell-cell junction organization | 63/2897 | 200/18723 | 9.15e-09 | 7.80e-07 | 63 |
GO:00070431 | Colorectum | SER | cell-cell junction assembly | 45/2897 | 146/18723 | 2.23e-06 | 9.31e-05 | 45 |
GO:00343291 | Colorectum | SER | cell junction assembly | 100/2897 | 420/18723 | 4.23e-06 | 1.61e-04 | 100 |
GO:00452162 | Colorectum | MSS | cell-cell junction organization | 69/3467 | 200/18723 | 5.07e-08 | 2.70e-06 | 69 |
GO:00343292 | Colorectum | MSS | cell junction assembly | 120/3467 | 420/18723 | 2.51e-07 | 1.07e-05 | 120 |
GO:00070432 | Colorectum | MSS | cell-cell junction assembly | 50/3467 | 146/18723 | 4.24e-06 | 1.21e-04 | 50 |
GO:00343321 | Colorectum | MSS | adherens junction organization | 18/3467 | 49/18723 | 2.03e-03 | 1.74e-02 | 18 |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
CDH18 | SNV | Missense_Mutation | c.1517N>G | p.Ile506Ser | p.I506S | Q13634 | protein_coding | deleterious(0.01) | probably_damaging(0.998) | TCGA-A1-A0SO-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | SD | ||
CDH18 | SNV | Missense_Mutation | c.319N>G | p.Thr107Ala | p.T107A | Q13634 | protein_coding | deleterious(0) | probably_damaging(0.952) | TCGA-AR-A1AI-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | cytoxan | PD | |
CDH18 | SNV | Missense_Mutation | novel | c.2002A>C | p.Thr668Pro | p.T668P | Q13634 | protein_coding | deleterious(0) | probably_damaging(0.992) | TCGA-B6-A0RS-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
CDH18 | SNV | Missense_Mutation | novel | c.1790T>G | p.Val597Gly | p.V597G | Q13634 | protein_coding | tolerated(0.1) | benign(0.15) | TCGA-BH-A0HY-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | taxotere | CR |
CDH18 | insertion | In_Frame_Ins | novel | c.3_4insCAACTT | p.Met1_Lys2insGlnLeu | p.M1_K2insQL | Q13634 | protein_coding | TCGA-AO-A128-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | SD | ||
CDH18 | deletion | Frame_Shift_Del | c.367delN | p.His123ThrfsTer59 | p.H123Tfs*59 | Q13634 | protein_coding | TCGA-D8-A27V-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | tamoxiphen | SD | |||
CDH18 | deletion | Frame_Shift_Del | novel | c.825_858delATATGTTCCTGAGTCAGCTCAAGTTGGTTCAGCT | p.Tyr276LeufsTer17 | p.Y276Lfs*17 | Q13634 | protein_coding | TCGA-GM-A2DH-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | taxol | CR | ||
CDH18 | SNV | Missense_Mutation | c.1108N>G | p.Leu370Val | p.L370V | Q13634 | protein_coding | tolerated(1) | benign(0.04) | TCGA-FU-A3HY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR | |
CDH18 | SNV | Missense_Mutation | c.2357C>T | p.Ser786Phe | p.S786F | Q13634 | protein_coding | deleterious(0) | benign(0.115) | TCGA-IR-A3LA-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR | |
CDH18 | SNV | Missense_Mutation | rs750768779 | c.628G>A | p.Val210Ile | p.V210I | Q13634 | protein_coding | tolerated(0.1) | probably_damaging(0.958) | TCGA-VS-A9UL-01 | Cervix | cervical & endocervical cancer | Female | >=65 | III/IV | Unknown | Unknown | PD |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |