Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: CDH18

Gene summary for CDH18

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

CDH18

Gene ID

1016

Gene namecadherin 18
Gene AliasCDH14
Cytomap5p14.3
Gene Typeprotein-coding
GO ID

GO:0000902

UniProtAcc

Q13634


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
1016CDH18HTA11_696_2000001011HumanColorectumAD1.07e-061.87e-01-0.1464
1016CDH18HTA11_866_2000001011HumanColorectumAD5.45e-031.04e-01-0.1001
1016CDH18HTA11_1391_2000001011HumanColorectumAD5.77e-031.93e-01-0.059
1016CDH18HTA11_9408_2000001011HumanColorectumAD9.43e-181.03e+000.0451
1016CDH18HTA11_6801_2000001011HumanColorectumSER3.73e-106.54e-010.0171
1016CDH18HTA11_99999971662_82457HumanColorectumMSS7.46e-195.25e-010.3859
1016CDH18HTA11_99999973899_84307HumanColorectumMSS5.90e-189.18e-010.2585
1016CDH18HTA11_99999974143_84620HumanColorectumMSS1.74e-941.97e+000.3005
Page: 1 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
Colorectum (GSE201348)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.FAP: Familial adenomatous polyposis
CRC: Colorectal cancer
Colorectum (HTA11)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AD: Adenomas
SER: Sessile serrated lesions
MSI-H: Microsatellite-high colorectal cancer
MSS: Microsatellite stable colorectal cancer
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:0045216ColorectumADcell-cell junction organization80/3918200/187235.57e-104.58e-0880
GO:0034329ColorectumADcell junction assembly136/3918420/187232.02e-081.15e-06136
GO:0007043ColorectumADcell-cell junction assembly57/3918146/187234.18e-071.61e-0557
GO:0034332ColorectumADadherens junction organization20/391849/187231.23e-031.09e-0220
GO:00452161ColorectumSERcell-cell junction organization63/2897200/187239.15e-097.80e-0763
GO:00070431ColorectumSERcell-cell junction assembly45/2897146/187232.23e-069.31e-0545
GO:00343291ColorectumSERcell junction assembly100/2897420/187234.23e-061.61e-04100
GO:00452162ColorectumMSScell-cell junction organization69/3467200/187235.07e-082.70e-0669
GO:00343292ColorectumMSScell junction assembly120/3467420/187232.51e-071.07e-05120
GO:00070432ColorectumMSScell-cell junction assembly50/3467146/187234.24e-061.21e-0450
GO:00343321ColorectumMSSadherens junction organization18/346749/187232.03e-031.74e-0218
Page: 1 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
CDH18SNVMissense_Mutationc.1517N>Gp.Ile506Serp.I506SQ13634protein_codingdeleterious(0.01)probably_damaging(0.998)TCGA-A1-A0SO-01Breastbreast invasive carcinomaFemale>=65I/IIChemotherapySD
CDH18SNVMissense_Mutationc.319N>Gp.Thr107Alap.T107AQ13634protein_codingdeleterious(0)probably_damaging(0.952)TCGA-AR-A1AI-01Breastbreast invasive carcinomaFemale<65I/IIChemotherapycytoxanPD
CDH18SNVMissense_Mutationnovelc.2002A>Cp.Thr668Prop.T668PQ13634protein_codingdeleterious(0)probably_damaging(0.992)TCGA-B6-A0RS-01Breastbreast invasive carcinomaFemale<65I/IIUnknownUnknownPD
CDH18SNVMissense_Mutationnovelc.1790T>Gp.Val597Glyp.V597GQ13634protein_codingtolerated(0.1)benign(0.15)TCGA-BH-A0HY-01Breastbreast invasive carcinomaFemale<65I/IIHormone TherapytaxotereCR
CDH18insertionIn_Frame_Insnovelc.3_4insCAACTTp.Met1_Lys2insGlnLeup.M1_K2insQLQ13634protein_codingTCGA-AO-A128-01Breastbreast invasive carcinomaFemale<65I/IIChemotherapydoxorubicinSD
CDH18deletionFrame_Shift_Delc.367delNp.His123ThrfsTer59p.H123Tfs*59Q13634protein_codingTCGA-D8-A27V-01Breastbreast invasive carcinomaFemale<65I/IIHormone TherapytamoxiphenSD
CDH18deletionFrame_Shift_Delnovelc.825_858delATATGTTCCTGAGTCAGCTCAAGTTGGTTCAGCTp.Tyr276LeufsTer17p.Y276Lfs*17Q13634protein_codingTCGA-GM-A2DH-01Breastbreast invasive carcinomaFemale<65I/IIChemotherapytaxolCR
CDH18SNVMissense_Mutationc.1108N>Gp.Leu370Valp.L370VQ13634protein_codingtolerated(1)benign(0.04)TCGA-FU-A3HY-01Cervixcervical & endocervical cancerFemale<65I/IIChemotherapycisplatinCR
CDH18SNVMissense_Mutationc.2357C>Tp.Ser786Phep.S786FQ13634protein_codingdeleterious(0)benign(0.115)TCGA-IR-A3LA-01Cervixcervical & endocervical cancerFemale<65I/IIChemotherapycisplatinCR
CDH18SNVMissense_Mutationrs750768779c.628G>Ap.Val210Ilep.V210IQ13634protein_codingtolerated(0.1)probably_damaging(0.958)TCGA-VS-A9UL-01Cervixcervical & endocervical cancerFemale>=65III/IVUnknownUnknownPD
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1