![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: AGFG2 |
Gene summary for AGFG2 |
![]() |
Gene information | Species | Human | Gene symbol | AGFG2 | Gene ID | 3268 |
Gene name | ArfGAP with FG repeats 2 | |
Gene Alias | HRBL | |
Cytomap | 7q22.1 | |
Gene Type | protein-coding | GO ID | GO:0008150 | UniProtAcc | A4D2D6 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
3268 | AGFG2 | HTA11_347_2000001011 | Human | Colorectum | AD | 4.11e-20 | 6.41e-01 | -0.1954 |
3268 | AGFG2 | HTA11_83_2000001011 | Human | Colorectum | SER | 6.11e-03 | 4.23e-01 | -0.1526 |
3268 | AGFG2 | HTA11_696_2000001011 | Human | Colorectum | AD | 1.52e-03 | 3.40e-01 | -0.1464 |
3268 | AGFG2 | HTA11_1391_2000001011 | Human | Colorectum | AD | 5.75e-03 | 3.25e-01 | -0.059 |
3268 | AGFG2 | A015-C-203 | Human | Colorectum | FAP | 7.00e-04 | -1.62e-02 | -0.1294 |
3268 | AGFG2 | A015-C-006 | Human | Colorectum | FAP | 2.37e-04 | -2.13e-01 | -0.0994 |
3268 | AGFG2 | A015-C-104 | Human | Colorectum | FAP | 5.45e-05 | -7.21e-02 | -0.1899 |
3268 | AGFG2 | A002-C-016 | Human | Colorectum | FAP | 4.02e-02 | -8.79e-02 | 0.0521 |
3268 | AGFG2 | A002-C-116 | Human | Colorectum | FAP | 8.68e-07 | -7.73e-02 | -0.0452 |
3268 | AGFG2 | HCC1_Meng | Human | Liver | HCC | 2.68e-35 | -2.76e-02 | 0.0246 |
3268 | AGFG2 | HCC1 | Human | Liver | HCC | 4.26e-06 | 3.78e+00 | 0.5336 |
3268 | AGFG2 | HCC2 | Human | Liver | HCC | 1.20e-02 | 3.16e+00 | 0.5341 |
3268 | AGFG2 | S014 | Human | Liver | HCC | 1.06e-02 | 3.39e-01 | 0.2254 |
3268 | AGFG2 | S027 | Human | Liver | HCC | 6.11e-22 | 1.99e+00 | 0.2446 |
3268 | AGFG2 | S028 | Human | Liver | HCC | 1.14e-38 | 2.28e+00 | 0.2503 |
3268 | AGFG2 | S029 | Human | Liver | HCC | 4.65e-44 | 2.61e+00 | 0.2581 |
3268 | AGFG2 | HTA12-23-1 | Human | Pancreas | PDAC | 2.25e-04 | 4.94e-01 | 0.3405 |
3268 | AGFG2 | HTA12-26-1 | Human | Pancreas | PDAC | 2.67e-04 | 3.00e-01 | 0.3728 |
3268 | AGFG2 | HTA12-29-1 | Human | Pancreas | PDAC | 2.32e-13 | 3.39e-01 | 0.3722 |
3268 | AGFG2 | HTA12-30-1 | Human | Pancreas | PDAC | 1.14e-02 | 7.69e-01 | 0.3671 |
Page: 1 2 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
AGFG2 | SNV | Missense_Mutation | c.283N>A | p.Glu95Lys | p.E95K | O95081 | protein_coding | deleterious(0) | probably_damaging(0.996) | TCGA-A1-A0SI-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |
AGFG2 | SNV | Missense_Mutation | c.985G>A | p.Gly329Ser | p.G329S | O95081 | protein_coding | tolerated(0.29) | benign(0.007) | TCGA-A8-A09Q-01 | Breast | breast invasive carcinoma | Female | >=65 | III/IV | Hormone Therapy | anastrozole | SD | |
AGFG2 | SNV | Missense_Mutation | c.694N>A | p.Asp232Asn | p.D232N | O95081 | protein_coding | deleterious(0) | probably_damaging(0.989) | TCGA-AN-A0FT-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |
AGFG2 | SNV | Missense_Mutation | rs149626460 | c.1043C>T | p.Thr348Met | p.T348M | O95081 | protein_coding | tolerated(0.14) | benign(0.007) | TCGA-BH-A1EU-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
AGFG2 | SNV | Missense_Mutation | c.977C>A | p.Pro326His | p.P326H | O95081 | protein_coding | deleterious(0.01) | benign(0.275) | TCGA-D8-A1XK-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicine+cyclophosphamide | SD | |
AGFG2 | insertion | Nonsense_Mutation | novel | c.1222_1223insTTCGTGGCCCTGATTTGATCTTCACAGTAGCCCTATGAGA | p.Pro408LeufsTer13 | p.P408Lfs*13 | O95081 | protein_coding | TCGA-A2-A0D1-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | taxotere | SD | ||
AGFG2 | deletion | In_Frame_Del | novel | c.1263_1283delGTTCCCCCCGCAGACCCCGCT | p.Phe422_Leu428del | p.F422_L428del | O95081 | protein_coding | TCGA-AN-A0FL-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
AGFG2 | insertion | Frame_Shift_Ins | novel | c.460_461insAATA | p.Pro154GlnfsTer29 | p.P154Qfs*29 | O95081 | protein_coding | TCGA-AO-A0JD-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | cyclophosphamide | SD | ||
AGFG2 | insertion | Nonsense_Mutation | novel | c.461_462insAATATAGCAACTATTGCATGG | p.Pro154_Thr155insIleTerGlnLeuLeuHisGly | p.P154_T155insI*QLLHG | O95081 | protein_coding | TCGA-AO-A0JD-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | cyclophosphamide | SD | ||
AGFG2 | SNV | Missense_Mutation | rs371963111 | c.1006G>A | p.Gly336Arg | p.G336R | O95081 | protein_coding | tolerated(0.06) | probably_damaging(0.999) | TCGA-2W-A8YY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
Page: 1 2 3 4 5 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |