![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: KRT14 |
Gene summary for KRT14 |
![]() |
Gene information | Species | Human | Gene symbol | KRT14 | Gene ID | 3861 |
Gene name | keratin 14 | |
Gene Alias | CK14 | |
Cytomap | 17q21.2 | |
Gene Type | protein-coding | GO ID | GO:0006996 | UniProtAcc | P02533 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
3861 | KRT14 | GSM4909277 | Human | Breast | Precancer | 2.17e-04 | 8.88e-01 | 0.0177 |
3861 | KRT14 | GSM4909281 | Human | Breast | IDC | 2.03e-28 | 8.71e-01 | 0.21 |
3861 | KRT14 | GSM4909282 | Human | Breast | IDC | 4.66e-116 | 1.65e+00 | -0.0288 |
3861 | KRT14 | GSM4909285 | Human | Breast | IDC | 1.23e-111 | 1.57e+00 | 0.21 |
3861 | KRT14 | GSM4909287 | Human | Breast | IDC | 2.79e-05 | -2.70e-01 | 0.2057 |
3861 | KRT14 | GSM4909288 | Human | Breast | IDC | 2.88e-05 | 5.14e-01 | 0.0988 |
3861 | KRT14 | GSM4909290 | Human | Breast | IDC | 1.25e-13 | -4.18e-01 | 0.2096 |
3861 | KRT14 | GSM4909291 | Human | Breast | IDC | 5.65e-11 | -4.18e-01 | 0.1753 |
3861 | KRT14 | GSM4909293 | Human | Breast | IDC | 1.35e-10 | -2.73e-01 | 0.1581 |
3861 | KRT14 | GSM4909294 | Human | Breast | IDC | 7.37e-14 | -3.18e-01 | 0.2022 |
3861 | KRT14 | GSM4909296 | Human | Breast | IDC | 2.96e-14 | -3.25e-01 | 0.1524 |
3861 | KRT14 | GSM4909297 | Human | Breast | IDC | 6.43e-16 | -3.99e-01 | 0.1517 |
3861 | KRT14 | GSM4909298 | Human | Breast | IDC | 8.35e-07 | -2.72e-01 | 0.1551 |
3861 | KRT14 | GSM4909299 | Human | Breast | IDC | 1.60e-31 | 9.33e-01 | 0.035 |
3861 | KRT14 | GSM4909300 | Human | Breast | IDC | 1.83e-16 | 9.30e-01 | 0.0334 |
3861 | KRT14 | GSM4909301 | Human | Breast | IDC | 7.78e-22 | -4.18e-01 | 0.1577 |
3861 | KRT14 | GSM4909302 | Human | Breast | IDC | 2.12e-10 | -3.11e-01 | 0.1545 |
3861 | KRT14 | GSM4909303 | Human | Breast | IDC | 1.35e-02 | -4.00e-01 | 0.0438 |
3861 | KRT14 | GSM4909304 | Human | Breast | IDC | 7.78e-22 | -4.15e-01 | 0.1636 |
3861 | KRT14 | GSM4909305 | Human | Breast | IDC | 1.12e-12 | 7.39e-01 | 0.0436 |
Page: 1 2 3 4 5 6 7 8 9 10 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00100389 | Breast | Precancer | response to metal ion | 47/1080 | 373/18723 | 3.88e-07 | 1.79e-05 | 47 |
GO:00075688 | Breast | Precancer | aging | 41/1080 | 339/18723 | 5.95e-06 | 1.71e-04 | 41 |
GO:00093148 | Breast | Precancer | response to radiation | 47/1080 | 456/18723 | 8.39e-05 | 1.62e-03 | 47 |
GO:00102125 | Breast | Precancer | response to ionizing radiation | 21/1080 | 148/18723 | 1.19e-04 | 2.13e-03 | 21 |
GO:0045104 | Breast | Precancer | intermediate filament cytoskeleton organization | 11/1080 | 51/18723 | 1.26e-04 | 2.22e-03 | 11 |
GO:0045103 | Breast | Precancer | intermediate filament-based process | 11/1080 | 52/18723 | 1.52e-04 | 2.60e-03 | 11 |
GO:00085445 | Breast | Precancer | epidermis development | 35/1080 | 324/18723 | 2.71e-04 | 3.96e-03 | 35 |
GO:00100435 | Breast | Precancer | response to zinc ion | 9/1080 | 58/18723 | 5.67e-03 | 4.08e-02 | 9 |
GO:001003814 | Breast | IDC | response to metal ion | 65/1434 | 373/18723 | 2.95e-10 | 3.42e-08 | 65 |
GO:000756813 | Breast | IDC | aging | 52/1434 | 339/18723 | 1.14e-06 | 5.10e-05 | 52 |
GO:001021213 | Breast | IDC | response to ionizing radiation | 28/1434 | 148/18723 | 6.85e-06 | 2.09e-04 | 28 |
GO:000931412 | Breast | IDC | response to radiation | 62/1434 | 456/18723 | 6.91e-06 | 2.10e-04 | 62 |
GO:001004311 | Breast | IDC | response to zinc ion | 13/1434 | 58/18723 | 3.59e-04 | 5.18e-03 | 13 |
GO:000854412 | Breast | IDC | epidermis development | 41/1434 | 324/18723 | 1.03e-03 | 1.14e-02 | 41 |
GO:00451041 | Breast | IDC | intermediate filament cytoskeleton organization | 11/1434 | 51/18723 | 1.40e-03 | 1.44e-02 | 11 |
GO:00451031 | Breast | IDC | intermediate filament-based process | 11/1434 | 52/18723 | 1.66e-03 | 1.63e-02 | 11 |
GO:001003824 | Breast | DCIS | response to metal ion | 65/1390 | 373/18723 | 8.03e-11 | 9.88e-09 | 65 |
GO:000756823 | Breast | DCIS | aging | 50/1390 | 339/18723 | 2.38e-06 | 8.46e-05 | 50 |
GO:000931422 | Breast | DCIS | response to radiation | 62/1390 | 456/18723 | 2.56e-06 | 8.87e-05 | 62 |
GO:001021223 | Breast | DCIS | response to ionizing radiation | 28/1390 | 148/18723 | 3.79e-06 | 1.16e-04 | 28 |
Page: 1 2 3 4 5 6 7 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa0491518 | Breast | Precancer | Estrogen signaling pathway | 28/684 | 138/8465 | 4.10e-06 | 5.39e-05 | 4.13e-05 | 28 |
hsa0491519 | Breast | Precancer | Estrogen signaling pathway | 28/684 | 138/8465 | 4.10e-06 | 5.39e-05 | 4.13e-05 | 28 |
hsa0491523 | Breast | IDC | Estrogen signaling pathway | 35/867 | 138/8465 | 2.55e-07 | 5.18e-06 | 3.88e-06 | 35 |
hsa0491533 | Breast | IDC | Estrogen signaling pathway | 35/867 | 138/8465 | 2.55e-07 | 5.18e-06 | 3.88e-06 | 35 |
hsa0491542 | Breast | DCIS | Estrogen signaling pathway | 35/846 | 138/8465 | 1.40e-07 | 2.51e-06 | 1.85e-06 | 35 |
hsa05150 | Breast | DCIS | Staphylococcus aureus infection | 19/846 | 96/8465 | 2.68e-03 | 1.67e-02 | 1.23e-02 | 19 |
hsa0491552 | Breast | DCIS | Estrogen signaling pathway | 35/846 | 138/8465 | 1.40e-07 | 2.51e-06 | 1.85e-06 | 35 |
hsa051501 | Breast | DCIS | Staphylococcus aureus infection | 19/846 | 96/8465 | 2.68e-03 | 1.67e-02 | 1.23e-02 | 19 |
hsa0491520 | Cervix | CC | Estrogen signaling pathway | 44/1267 | 138/8465 | 3.55e-07 | 3.97e-06 | 2.35e-06 | 44 |
hsa04915110 | Cervix | CC | Estrogen signaling pathway | 44/1267 | 138/8465 | 3.55e-07 | 3.97e-06 | 2.35e-06 | 44 |
hsa051504 | Cervix | HSIL_HPV | Staphylococcus aureus infection | 21/459 | 96/8465 | 2.93e-08 | 1.43e-06 | 1.16e-06 | 21 |
hsa0491524 | Cervix | HSIL_HPV | Estrogen signaling pathway | 19/459 | 138/8465 | 1.54e-04 | 1.74e-03 | 1.40e-03 | 19 |
hsa0515011 | Cervix | HSIL_HPV | Staphylococcus aureus infection | 21/459 | 96/8465 | 2.93e-08 | 1.43e-06 | 1.16e-06 | 21 |
hsa0491534 | Cervix | HSIL_HPV | Estrogen signaling pathway | 19/459 | 138/8465 | 1.54e-04 | 1.74e-03 | 1.40e-03 | 19 |
hsa051502 | Cervix | N_HPV | Staphylococcus aureus infection | 15/349 | 96/8465 | 7.81e-06 | 1.01e-04 | 7.90e-05 | 15 |
hsa0491543 | Cervix | N_HPV | Estrogen signaling pathway | 16/349 | 138/8465 | 1.68e-04 | 1.53e-03 | 1.19e-03 | 16 |
hsa051503 | Cervix | N_HPV | Staphylococcus aureus infection | 15/349 | 96/8465 | 7.81e-06 | 1.01e-04 | 7.90e-05 | 15 |
hsa0491553 | Cervix | N_HPV | Estrogen signaling pathway | 16/349 | 138/8465 | 1.68e-04 | 1.53e-03 | 1.19e-03 | 16 |
hsa0491529 | Oral cavity | EOLP | Estrogen signaling pathway | 38/1218 | 138/8465 | 3.78e-05 | 1.82e-04 | 1.07e-04 | 38 |
hsa04915113 | Oral cavity | EOLP | Estrogen signaling pathway | 38/1218 | 138/8465 | 3.78e-05 | 1.82e-04 | 1.07e-04 | 38 |
Page: 1 2 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
KRT14 | SNV | Missense_Mutation | novel | c.498N>A | p.Phe166Leu | p.F166L | P02533 | protein_coding | deleterious(0.04) | benign(0.029) | TCGA-P3-A5QA-01 | Oral cavity | head & neck squamous cell carcinoma | Male | <65 | I/II | Unknown | Unknown | PD |
KRT14 | insertion | Frame_Shift_Ins | novel | c.696_715dupAGCTGACCTGGAGATGCAGA | p.Ile239LysfsTer11 | p.I239Kfs*11 | P02533 | protein_coding | TCGA-BA-5556-01 | Oral cavity | head & neck squamous cell carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
KRT14 | insertion | In_Frame_Ins | novel | c.609-1_609insTCTGGCCGCGGATGACTTCCGCACCAA | p.Thr202_Lys203insAsnLeuAlaAlaAspAspPheArgThr | p.T202_K203insNLAADDFRT | P02533 | protein_coding | TCGA-CV-7425-01 | Oral cavity | head & neck squamous cell carcinoma | Female | >=65 | III/IV | Unknown | Unknown | PD | ||
KRT14 | SNV | Missense_Mutation | rs778867001 | c.863N>A | p.Arg288His | p.R288H | P02533 | protein_coding | deleterious(0.01) | possibly_damaging(0.828) | TCGA-BR-6452-01 | Stomach | stomach adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
KRT14 | SNV | Missense_Mutation | rs747163920 | c.862N>T | p.Arg288Cys | p.R288C | P02533 | protein_coding | deleterious(0.03) | possibly_damaging(0.735) | TCGA-HJ-7597-01 | Stomach | stomach adenocarcinoma | Female | >=65 | I/II | Chemotherapy | fluorouracil | CR |
KRT14 | SNV | Missense_Mutation | c.401G>A | p.Arg134His | p.R134H | P02533 | protein_coding | tolerated(0.1) | benign(0.36) | TCGA-IN-AB1V-01 | Stomach | stomach adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 7 8 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |