Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: KRT14

Gene summary for KRT14

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

KRT14

Gene ID

3861

Gene namekeratin 14
Gene AliasCK14
Cytomap17q21.2
Gene Typeprotein-coding
GO ID

GO:0006996

UniProtAcc

P02533


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
3861KRT14GSM4909277HumanBreastPrecancer2.17e-048.88e-010.0177
3861KRT14GSM4909281HumanBreastIDC2.03e-288.71e-010.21
3861KRT14GSM4909282HumanBreastIDC4.66e-1161.65e+00-0.0288
3861KRT14GSM4909285HumanBreastIDC1.23e-1111.57e+000.21
3861KRT14GSM4909287HumanBreastIDC2.79e-05-2.70e-010.2057
3861KRT14GSM4909288HumanBreastIDC2.88e-055.14e-010.0988
3861KRT14GSM4909290HumanBreastIDC1.25e-13-4.18e-010.2096
3861KRT14GSM4909291HumanBreastIDC5.65e-11-4.18e-010.1753
3861KRT14GSM4909293HumanBreastIDC1.35e-10-2.73e-010.1581
3861KRT14GSM4909294HumanBreastIDC7.37e-14-3.18e-010.2022
3861KRT14GSM4909296HumanBreastIDC2.96e-14-3.25e-010.1524
3861KRT14GSM4909297HumanBreastIDC6.43e-16-3.99e-010.1517
3861KRT14GSM4909298HumanBreastIDC8.35e-07-2.72e-010.1551
3861KRT14GSM4909299HumanBreastIDC1.60e-319.33e-010.035
3861KRT14GSM4909300HumanBreastIDC1.83e-169.30e-010.0334
3861KRT14GSM4909301HumanBreastIDC7.78e-22-4.18e-010.1577
3861KRT14GSM4909302HumanBreastIDC2.12e-10-3.11e-010.1545
3861KRT14GSM4909303HumanBreastIDC1.35e-02-4.00e-010.0438
3861KRT14GSM4909304HumanBreastIDC7.78e-22-4.15e-010.1636
3861KRT14GSM4909305HumanBreastIDC1.12e-127.39e-010.0436
Page: 1 2 3 4 5 6 7 8 9 10 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
BreastThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.IDC: Invasive ductal carcinoma
DCIS: Ductal carcinoma in situ
Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers
CervixThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.CC: Cervix cancer
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions
N_HPV: HPV-infected normal cervix
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
ProstateThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.BPH: Benign Prostatic Hyperplasia
SkinThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AK: Actinic keratosis
cSCC: Cutaneous squamous cell carcinoma
SCCIS:squamous cell carcinoma in situ
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:00100389BreastPrecancerresponse to metal ion47/1080373/187233.88e-071.79e-0547
GO:00075688BreastPrecanceraging41/1080339/187235.95e-061.71e-0441
GO:00093148BreastPrecancerresponse to radiation47/1080456/187238.39e-051.62e-0347
GO:00102125BreastPrecancerresponse to ionizing radiation21/1080148/187231.19e-042.13e-0321
GO:0045104BreastPrecancerintermediate filament cytoskeleton organization11/108051/187231.26e-042.22e-0311
GO:0045103BreastPrecancerintermediate filament-based process11/108052/187231.52e-042.60e-0311
GO:00085445BreastPrecancerepidermis development35/1080324/187232.71e-043.96e-0335
GO:00100435BreastPrecancerresponse to zinc ion9/108058/187235.67e-034.08e-029
GO:001003814BreastIDCresponse to metal ion65/1434373/187232.95e-103.42e-0865
GO:000756813BreastIDCaging52/1434339/187231.14e-065.10e-0552
GO:001021213BreastIDCresponse to ionizing radiation28/1434148/187236.85e-062.09e-0428
GO:000931412BreastIDCresponse to radiation62/1434456/187236.91e-062.10e-0462
GO:001004311BreastIDCresponse to zinc ion13/143458/187233.59e-045.18e-0313
GO:000854412BreastIDCepidermis development41/1434324/187231.03e-031.14e-0241
GO:00451041BreastIDCintermediate filament cytoskeleton organization11/143451/187231.40e-031.44e-0211
GO:00451031BreastIDCintermediate filament-based process11/143452/187231.66e-031.63e-0211
GO:001003824BreastDCISresponse to metal ion65/1390373/187238.03e-119.88e-0965
GO:000756823BreastDCISaging50/1390339/187232.38e-068.46e-0550
GO:000931422BreastDCISresponse to radiation62/1390456/187232.56e-068.87e-0562
GO:001021223BreastDCISresponse to ionizing radiation28/1390148/187233.79e-061.16e-0428
Page: 1 2 3 4 5 6 7 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
hsa0491518BreastPrecancerEstrogen signaling pathway28/684138/84654.10e-065.39e-054.13e-0528
hsa0491519BreastPrecancerEstrogen signaling pathway28/684138/84654.10e-065.39e-054.13e-0528
hsa0491523BreastIDCEstrogen signaling pathway35/867138/84652.55e-075.18e-063.88e-0635
hsa0491533BreastIDCEstrogen signaling pathway35/867138/84652.55e-075.18e-063.88e-0635
hsa0491542BreastDCISEstrogen signaling pathway35/846138/84651.40e-072.51e-061.85e-0635
hsa05150BreastDCISStaphylococcus aureus infection19/84696/84652.68e-031.67e-021.23e-0219
hsa0491552BreastDCISEstrogen signaling pathway35/846138/84651.40e-072.51e-061.85e-0635
hsa051501BreastDCISStaphylococcus aureus infection19/84696/84652.68e-031.67e-021.23e-0219
hsa0491520CervixCCEstrogen signaling pathway44/1267138/84653.55e-073.97e-062.35e-0644
hsa04915110CervixCCEstrogen signaling pathway44/1267138/84653.55e-073.97e-062.35e-0644
hsa051504CervixHSIL_HPVStaphylococcus aureus infection21/45996/84652.93e-081.43e-061.16e-0621
hsa0491524CervixHSIL_HPVEstrogen signaling pathway19/459138/84651.54e-041.74e-031.40e-0319
hsa0515011CervixHSIL_HPVStaphylococcus aureus infection21/45996/84652.93e-081.43e-061.16e-0621
hsa0491534CervixHSIL_HPVEstrogen signaling pathway19/459138/84651.54e-041.74e-031.40e-0319
hsa051502CervixN_HPVStaphylococcus aureus infection15/34996/84657.81e-061.01e-047.90e-0515
hsa0491543CervixN_HPVEstrogen signaling pathway16/349138/84651.68e-041.53e-031.19e-0316
hsa051503CervixN_HPVStaphylococcus aureus infection15/34996/84657.81e-061.01e-047.90e-0515
hsa0491553CervixN_HPVEstrogen signaling pathway16/349138/84651.68e-041.53e-031.19e-0316
hsa0491529Oral cavityEOLPEstrogen signaling pathway38/1218138/84653.78e-051.82e-041.07e-0438
hsa04915113Oral cavityEOLPEstrogen signaling pathway38/1218138/84653.78e-051.82e-041.07e-0438
Page: 1 2 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
KRT14SNVMissense_Mutationnovelc.498N>Ap.Phe166Leup.F166LP02533protein_codingdeleterious(0.04)benign(0.029)TCGA-P3-A5QA-01Oral cavityhead & neck squamous cell carcinomaMale<65I/IIUnknownUnknownPD
KRT14insertionFrame_Shift_Insnovelc.696_715dupAGCTGACCTGGAGATGCAGAp.Ile239LysfsTer11p.I239Kfs*11P02533protein_codingTCGA-BA-5556-01Oral cavityhead & neck squamous cell carcinomaFemale<65I/IIUnknownUnknownSD
KRT14insertionIn_Frame_Insnovelc.609-1_609insTCTGGCCGCGGATGACTTCCGCACCAAp.Thr202_Lys203insAsnLeuAlaAlaAspAspPheArgThrp.T202_K203insNLAADDFRTP02533protein_codingTCGA-CV-7425-01Oral cavityhead & neck squamous cell carcinomaFemale>=65III/IVUnknownUnknownPD
KRT14SNVMissense_Mutationrs778867001c.863N>Ap.Arg288Hisp.R288HP02533protein_codingdeleterious(0.01)possibly_damaging(0.828)TCGA-BR-6452-01Stomachstomach adenocarcinomaFemale>=65I/IIUnknownUnknownSD
KRT14SNVMissense_Mutationrs747163920c.862N>Tp.Arg288Cysp.R288CP02533protein_codingdeleterious(0.03)possibly_damaging(0.735)TCGA-HJ-7597-01Stomachstomach adenocarcinomaFemale>=65I/IIChemotherapyfluorouracilCR
KRT14SNVMissense_Mutationc.401G>Ap.Arg134Hisp.R134HP02533protein_codingtolerated(0.1)benign(0.36)TCGA-IN-AB1V-01Stomachstomach adenocarcinomaMale<65I/IIUnknownUnknownSD
Page: 1 2 3 4 5 6 7 8 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1