![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: EPHA1 |
Gene summary for EPHA1 |
![]() |
Gene information | Species | Human | Gene symbol | EPHA1 | Gene ID | 2041 |
Gene name | EPH receptor A1 | |
Gene Alias | EPH | |
Cytomap | 7q34-q35 | |
Gene Type | protein-coding | GO ID | GO:0000902 | UniProtAcc | P21709 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
2041 | EPHA1 | LZE4T | Human | Esophagus | ESCC | 4.06e-02 | 9.54e-02 | 0.0811 |
2041 | EPHA1 | LZE20T | Human | Esophagus | ESCC | 5.52e-03 | 1.61e-01 | 0.0662 |
2041 | EPHA1 | LZE22T | Human | Esophagus | ESCC | 1.11e-02 | 2.93e-01 | 0.068 |
2041 | EPHA1 | LZE24T | Human | Esophagus | ESCC | 7.56e-06 | 1.35e-01 | 0.0596 |
2041 | EPHA1 | LZE21T | Human | Esophagus | ESCC | 2.94e-03 | 3.29e-01 | 0.0655 |
2041 | EPHA1 | LZE6T | Human | Esophagus | ESCC | 1.17e-02 | 1.73e-01 | 0.0845 |
2041 | EPHA1 | P1T-E | Human | Esophagus | ESCC | 1.34e-02 | 1.89e-01 | 0.0875 |
2041 | EPHA1 | P2T-E | Human | Esophagus | ESCC | 7.67e-06 | 1.15e-01 | 0.1177 |
2041 | EPHA1 | P4T-E | Human | Esophagus | ESCC | 5.83e-11 | 2.08e-01 | 0.1323 |
2041 | EPHA1 | P5T-E | Human | Esophagus | ESCC | 1.12e-03 | 9.88e-02 | 0.1327 |
2041 | EPHA1 | P8T-E | Human | Esophagus | ESCC | 4.79e-08 | 1.27e-01 | 0.0889 |
2041 | EPHA1 | P10T-E | Human | Esophagus | ESCC | 4.50e-05 | 1.51e-01 | 0.116 |
2041 | EPHA1 | P11T-E | Human | Esophagus | ESCC | 5.82e-07 | 2.65e-01 | 0.1426 |
2041 | EPHA1 | P12T-E | Human | Esophagus | ESCC | 6.89e-21 | 4.63e-01 | 0.1122 |
2041 | EPHA1 | P15T-E | Human | Esophagus | ESCC | 2.57e-21 | 4.98e-01 | 0.1149 |
2041 | EPHA1 | P16T-E | Human | Esophagus | ESCC | 1.67e-12 | 1.99e-01 | 0.1153 |
2041 | EPHA1 | P17T-E | Human | Esophagus | ESCC | 6.59e-03 | 2.23e-01 | 0.1278 |
2041 | EPHA1 | P20T-E | Human | Esophagus | ESCC | 1.45e-06 | 1.32e-01 | 0.1124 |
2041 | EPHA1 | P21T-E | Human | Esophagus | ESCC | 1.23e-17 | 3.94e-01 | 0.1617 |
2041 | EPHA1 | P22T-E | Human | Esophagus | ESCC | 1.70e-07 | 1.05e-01 | 0.1236 |
Page: 1 2 3 |
![]() |
Tissue | Expression Dynamics | Abbreviation |
Esophagus | ![]() | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias | ||
LGIN: Low-grade intraepithelial neoplasias |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:0010563111 | Esophagus | ESCC | negative regulation of phosphorus metabolic process | 274/8552 | 442/18723 | 2.32e-12 | 9.41e-11 | 274 |
GO:0045936111 | Esophagus | ESCC | negative regulation of phosphate metabolic process | 273/8552 | 441/18723 | 3.18e-12 | 1.25e-10 | 273 |
GO:0051348111 | Esophagus | ESCC | negative regulation of transferase activity | 177/8552 | 268/18723 | 1.08e-11 | 4.00e-10 | 177 |
GO:1902905111 | Esophagus | ESCC | positive regulation of supramolecular fiber organization | 142/8552 | 209/18723 | 5.51e-11 | 1.76e-09 | 142 |
GO:1902903111 | Esophagus | ESCC | regulation of supramolecular fiber organization | 237/8552 | 383/18723 | 9.06e-11 | 2.75e-09 | 237 |
GO:0042326111 | Esophagus | ESCC | negative regulation of phosphorylation | 237/8552 | 385/18723 | 1.86e-10 | 5.33e-09 | 237 |
GO:0001933111 | Esophagus | ESCC | negative regulation of protein phosphorylation | 213/8552 | 342/18723 | 3.54e-10 | 9.76e-09 | 213 |
GO:003367319 | Esophagus | ESCC | negative regulation of kinase activity | 154/8552 | 237/18723 | 1.38e-09 | 3.27e-08 | 154 |
GO:000646920 | Esophagus | ESCC | negative regulation of protein kinase activity | 140/8552 | 212/18723 | 1.53e-09 | 3.56e-08 | 140 |
GO:005149520 | Esophagus | ESCC | positive regulation of cytoskeleton organization | 147/8552 | 226/18723 | 2.93e-09 | 6.38e-08 | 147 |
GO:003158919 | Esophagus | ESCC | cell-substrate adhesion | 221/8552 | 363/18723 | 3.06e-09 | 6.62e-08 | 221 |
GO:001081020 | Esophagus | ESCC | regulation of cell-substrate adhesion | 144/8552 | 221/18723 | 3.55e-09 | 7.45e-08 | 144 |
GO:000701527 | Esophagus | ESCC | actin filament organization | 259/8552 | 442/18723 | 2.37e-08 | 4.50e-07 | 259 |
GO:004578527 | Esophagus | ESCC | positive regulation of cell adhesion | 255/8552 | 437/18723 | 5.07e-08 | 9.11e-07 | 255 |
GO:0032970111 | Esophagus | ESCC | regulation of actin filament-based process | 231/8552 | 397/18723 | 2.91e-07 | 4.20e-06 | 231 |
GO:001081126 | Esophagus | ESCC | positive regulation of cell-substrate adhesion | 84/8552 | 123/18723 | 3.18e-07 | 4.50e-06 | 84 |
GO:0032956111 | Esophagus | ESCC | regulation of actin cytoskeleton organization | 210/8552 | 358/18723 | 4.40e-07 | 6.00e-06 | 210 |
GO:011005327 | Esophagus | ESCC | regulation of actin filament organization | 166/8552 | 278/18723 | 1.54e-06 | 1.85e-05 | 166 |
GO:000195217 | Esophagus | ESCC | regulation of cell-matrix adhesion | 85/8552 | 128/18723 | 1.70e-06 | 2.02e-05 | 85 |
GO:004677710 | Esophagus | ESCC | protein autophosphorylation | 138/8552 | 227/18723 | 2.98e-06 | 3.38e-05 | 138 |
Page: 1 2 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa0436016 | Esophagus | ESCC | Axon guidance | 108/4205 | 182/8465 | 5.13e-03 | 1.30e-02 | 6.67e-03 | 108 |
hsa0436017 | Esophagus | ESCC | Axon guidance | 108/4205 | 182/8465 | 5.13e-03 | 1.30e-02 | 6.67e-03 | 108 |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
EFNA1 | EPHA1 | EFNA1_EPHA1 | EPHA | HNSCC | OSCC |
EFNA3 | EPHA1 | EFNA3_EPHA1 | EPHA | HNSCC | OSCC |
EFNA4 | EPHA1 | EFNA4_EPHA1 | EPHA | HNSCC | OSCC |
EFNA5 | EPHA1 | EFNA5_EPHA1 | EPHA | HNSCC | OSCC |
EFNA1 | EPHA1 | EFNA1_EPHA1 | EPHA | HNSCC | Precancer |
EFNA3 | EPHA1 | EFNA3_EPHA1 | EPHA | HNSCC | Precancer |
EFNA4 | EPHA1 | EFNA4_EPHA1 | EPHA | HNSCC | Precancer |
EFNA5 | EPHA1 | EFNA5_EPHA1 | EPHA | HNSCC | Precancer |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
EPHA1 | deletion | Frame_Shift_Del | c.1258delN | p.Glu420LysfsTer34 | p.E420Kfs*34 | P21709 | protein_coding | TCGA-55-7994-01 | Lung | lung adenocarcinoma | Male | >=65 | I/II | Chemotherapy | carboplatin | CR | |||
EPHA1 | deletion | Frame_Shift_Del | novel | c.880delN | p.Cys294ValfsTer46 | p.C294Vfs*46 | P21709 | protein_coding | TCGA-95-7043-01 | Lung | lung adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | PD | ||
EPHA1 | deletion | In_Frame_Del | novel | c.2629_2652delCAGGCACATCTGGAGCAACTGCTT | p.Gln877_Leu884del | p.Q877_L884del | P21709 | protein_coding | TCGA-95-A4VN-01 | Lung | lung adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
EPHA1 | SNV | Missense_Mutation | novel | c.94N>A | p.Asp32Asn | p.D32N | P21709 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-CR-6472-01 | Oral cavity | head & neck squamous cell carcinoma | Male | <65 | I/II | Chemotherapy | paclitaxel | SD |
EPHA1 | SNV | Missense_Mutation | novel | c.2511G>C | p.Lys837Asn | p.K837N | P21709 | protein_coding | deleterious(0.02) | benign(0.349) | TCGA-CV-7406-01 | Oral cavity | head & neck squamous cell carcinoma | Male | <65 | I/II | Unknown | Unknown | SD |
EPHA1 | SNV | Missense_Mutation | novel | c.2810N>T | p.Ala937Val | p.A937V | P21709 | protein_coding | tolerated(0.12) | benign(0.355) | TCGA-F7-A624-01 | Oral cavity | head & neck squamous cell carcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
EPHA1 | SNV | Missense_Mutation | novel | c.2490N>C | p.Met830Ile | p.M830I | P21709 | protein_coding | deleterious(0) | probably_damaging(0.944) | TCGA-MT-A67F-01 | Oral cavity | head & neck squamous cell carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
EPHA1 | SNV | Missense_Mutation | rs200235266 | c.737G>A | p.Arg246His | p.R246H | P21709 | protein_coding | deleterious(0.03) | benign(0.082) | TCGA-BR-4256-01 | Stomach | stomach adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
EPHA1 | SNV | Missense_Mutation | c.2419N>G | p.Ser807Gly | p.S807G | P21709 | protein_coding | deleterious(0) | probably_damaging(0.995) | TCGA-BR-4363-01 | Stomach | stomach adenocarcinoma | Female | <65 | III/IV | Unknown | Unknown | SD | |
EPHA1 | SNV | Missense_Mutation | novel | c.946N>T | p.Gly316Cys | p.G316C | P21709 | protein_coding | deleterious(0) | probably_damaging(0.969) | TCGA-BR-6705-01 | Stomach | stomach adenocarcinoma | Female | >=65 | III/IV | Unknown | Unknown | PD |
Page: 1 2 3 4 5 6 7 8 9 10 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
2041 | EPHA1 | DRUGGABLE GENOME, KINASE, TYROSINE KINASE | inhibitor | 249565804 | ||
2041 | EPHA1 | DRUGGABLE GENOME, KINASE, TYROSINE KINASE | inhibitor | CHEMBL24828 | VANDETANIB | |
2041 | EPHA1 | DRUGGABLE GENOME, KINASE, TYROSINE KINASE | inhibitor | 249565821 |
Page: 1 |