![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: PPM1D |
Gene summary for PPM1D |
![]() |
Gene information | Species | Human | Gene symbol | PPM1D | Gene ID | 8493 |
Gene name | protein phosphatase, Mg2+/Mn2+ dependent 1D | |
Gene Alias | IDDGIP | |
Cytomap | 17q23.2 | |
Gene Type | protein-coding | GO ID | GO:0000086 | UniProtAcc | A0A0S2Z4M2 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
8493 | PPM1D | LZE4T | Human | Esophagus | ESCC | 2.44e-10 | 3.27e-01 | 0.0811 |
8493 | PPM1D | LZE7T | Human | Esophagus | ESCC | 6.68e-03 | 2.13e-01 | 0.0667 |
8493 | PPM1D | LZE20T | Human | Esophagus | ESCC | 1.86e-03 | 1.27e-01 | 0.0662 |
8493 | PPM1D | LZE24T | Human | Esophagus | ESCC | 1.56e-18 | 3.74e-01 | 0.0596 |
8493 | PPM1D | LZE21T | Human | Esophagus | ESCC | 3.29e-04 | 2.95e-01 | 0.0655 |
8493 | PPM1D | P1T-E | Human | Esophagus | ESCC | 2.40e-08 | 5.14e-01 | 0.0875 |
8493 | PPM1D | P2T-E | Human | Esophagus | ESCC | 4.58e-38 | 6.77e-01 | 0.1177 |
8493 | PPM1D | P4T-E | Human | Esophagus | ESCC | 1.08e-05 | 1.65e-01 | 0.1323 |
8493 | PPM1D | P5T-E | Human | Esophagus | ESCC | 5.83e-05 | 6.27e-02 | 0.1327 |
8493 | PPM1D | P8T-E | Human | Esophagus | ESCC | 1.44e-15 | 2.35e-01 | 0.0889 |
8493 | PPM1D | P9T-E | Human | Esophagus | ESCC | 1.94e-05 | 1.57e-01 | 0.1131 |
8493 | PPM1D | P10T-E | Human | Esophagus | ESCC | 3.86e-11 | 2.22e-01 | 0.116 |
8493 | PPM1D | P11T-E | Human | Esophagus | ESCC | 1.29e-11 | 4.08e-01 | 0.1426 |
8493 | PPM1D | P12T-E | Human | Esophagus | ESCC | 2.08e-25 | 5.24e-01 | 0.1122 |
8493 | PPM1D | P15T-E | Human | Esophagus | ESCC | 9.23e-26 | 4.91e-01 | 0.1149 |
8493 | PPM1D | P16T-E | Human | Esophagus | ESCC | 1.77e-19 | 4.00e-01 | 0.1153 |
8493 | PPM1D | P20T-E | Human | Esophagus | ESCC | 7.86e-15 | 3.04e-01 | 0.1124 |
8493 | PPM1D | P21T-E | Human | Esophagus | ESCC | 9.89e-06 | 1.10e-01 | 0.1617 |
8493 | PPM1D | P22T-E | Human | Esophagus | ESCC | 2.03e-11 | 2.98e-01 | 0.1236 |
8493 | PPM1D | P23T-E | Human | Esophagus | ESCC | 8.75e-44 | 9.17e-01 | 0.108 |
Page: 1 2 3 |
![]() |
Tissue | Expression Dynamics | Abbreviation |
Esophagus | ![]() | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias | ||
LGIN: Low-grade intraepithelial neoplasias |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:004477216 | Esophagus | ESCC | mitotic cell cycle phase transition | 281/8552 | 424/18723 | 4.63e-18 | 4.45e-16 | 281 |
GO:0071496111 | Esophagus | ESCC | cellular response to external stimulus | 215/8552 | 320/18723 | 4.29e-15 | 2.43e-13 | 215 |
GO:0072331111 | Esophagus | ESCC | signal transduction by p53 class mediator | 121/8552 | 163/18723 | 9.61e-14 | 4.69e-12 | 121 |
GO:0031668111 | Esophagus | ESCC | cellular response to extracellular stimulus | 168/8552 | 246/18723 | 4.93e-13 | 2.23e-11 | 168 |
GO:0031669110 | Esophagus | ESCC | cellular response to nutrient levels | 148/8552 | 215/18723 | 4.58e-12 | 1.76e-10 | 148 |
GO:0031667111 | Esophagus | ESCC | response to nutrient levels | 289/8552 | 474/18723 | 9.25e-12 | 3.47e-10 | 289 |
GO:000931419 | Esophagus | ESCC | response to radiation | 277/8552 | 456/18723 | 4.42e-11 | 1.43e-09 | 277 |
GO:0009267110 | Esophagus | ESCC | cellular response to starvation | 110/8552 | 156/18723 | 2.63e-10 | 7.37e-09 | 110 |
GO:00434143 | Esophagus | ESCC | macromolecule methylation | 199/8552 | 316/18723 | 3.44e-10 | 9.57e-09 | 199 |
GO:004259419 | Esophagus | ESCC | response to starvation | 133/8552 | 197/18723 | 4.31e-10 | 1.14e-08 | 133 |
GO:001631110 | Esophagus | ESCC | dephosphorylation | 251/8552 | 417/18723 | 1.26e-09 | 2.99e-08 | 251 |
GO:00322592 | Esophagus | ESCC | methylation | 222/8552 | 364/18723 | 2.26e-09 | 5.09e-08 | 222 |
GO:004277014 | Esophagus | ESCC | signal transduction in response to DNA damage | 117/8552 | 172/18723 | 2.38e-09 | 5.32e-08 | 117 |
GO:00448394 | Esophagus | ESCC | cell cycle G2/M phase transition | 103/8552 | 148/18723 | 3.09e-09 | 6.67e-08 | 103 |
GO:000647018 | Esophagus | ESCC | protein dephosphorylation | 177/8552 | 281/18723 | 3.13e-09 | 6.72e-08 | 177 |
GO:00000864 | Esophagus | ESCC | G2/M transition of mitotic cell cycle | 96/8552 | 137/18723 | 6.00e-09 | 1.23e-07 | 96 |
GO:00400295 | Esophagus | ESCC | regulation of gene expression, epigenetic | 74/8552 | 105/18723 | 2.24e-07 | 3.42e-06 | 74 |
GO:00063673 | Esophagus | ESCC | transcription initiation from RNA polymerase II promoter | 56/8552 | 77/18723 | 1.30e-06 | 1.59e-05 | 56 |
GO:0030330110 | Esophagus | ESCC | DNA damage response, signal transduction by p53 class mediator | 53/8552 | 72/18723 | 1.34e-06 | 1.63e-05 | 53 |
GO:000635211 | Esophagus | ESCC | DNA-templated transcription, initiation | 86/8552 | 130/18723 | 1.88e-06 | 2.19e-05 | 86 |
Page: 1 2 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa0411524 | Esophagus | ESCC | p53 signaling pathway | 65/4205 | 74/8465 | 3.88e-12 | 6.50e-11 | 3.33e-11 | 65 |
hsa0411534 | Esophagus | ESCC | p53 signaling pathway | 65/4205 | 74/8465 | 3.88e-12 | 6.50e-11 | 3.33e-11 | 65 |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
PPM1D | SNV | Missense_Mutation | rs760201595 | c.1655N>A | p.Arg552Gln | p.R552Q | O15297 | protein_coding | deleterious_low_confidence(0.01) | possibly_damaging(0.86) | TCGA-BR-8680-01 | Stomach | stomach adenocarcinoma | Male | <65 | III/IV | Chemotherapy | oxaliplatin | CR |
PPM1D | SNV | Missense_Mutation | c.1109N>T | p.Ala370Val | p.A370V | O15297 | protein_coding | tolerated(0.62) | benign(0.047) | TCGA-CG-5721-01 | Stomach | stomach adenocarcinoma | Male | <65 | III/IV | Unknown | Unknown | SD | |
PPM1D | deletion | Frame_Shift_Del | rs758630849 | c.1344delN | p.Leu450Ter | p.L450* | O15297 | protein_coding | TCGA-BR-8487-01 | Stomach | stomach adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
PPM1D | deletion | Frame_Shift_Del | rs766595966 | c.1535delA | p.Asn512IlefsTer2 | p.N512Ifs*2 | O15297 | protein_coding | TCGA-HF-7132-01 | Stomach | stomach adenocarcinoma | Male | Unknown | I/II | Chemotherapy | fluorouracil | SD | ||
PPM1D | deletion | Frame_Shift_Del | rs766595966 | c.1535delA | p.Asn512IlefsTer2 | p.N512Ifs*2 | O15297 | protein_coding | TCGA-HU-A4GU-01 | Stomach | stomach adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD | ||
PPM1D | deletion | Frame_Shift_Del | rs766595966 | c.1529delN | p.Asn512IlefsTer2 | p.N512Ifs*2 | O15297 | protein_coding | TCGA-VQ-A8PO-01 | Stomach | stomach adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | PD | ||
PPM1D | insertion | Frame_Shift_Ins | novel | c.1403_1404insA | p.Asp470ArgfsTer6 | p.D470Rfs*6 | O15297 | protein_coding | TCGA-DJ-A1QE-01 | Thyroid | thyroid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD | ||
PPM1D | deletion | Frame_Shift_Del | novel | c.1434_1455delCGCTAAAGCCCTGACTTTAAGG | p.Cys478Ter | p.C478* | O15297 | protein_coding | TCGA-DJ-A1QL-01 | Thyroid | thyroid carcinoma | Male | >=65 | I/II | Unknown | Unknown | SD | ||
PPM1D | insertion | Frame_Shift_Ins | novel | c.1537_1538insC | p.Leu513SerfsTer15 | p.L513Sfs*15 | O15297 | protein_coding | TCGA-DJ-A3VL-01 | Thyroid | thyroid carcinoma | Male | <65 | I/II | Unknown | Unknown | PD | ||
PPM1D | insertion | Nonsense_Mutation | novel | c.1538_1539insCTGA | p.Leu513PhefsTer2 | p.L513Ffs*2 | O15297 | protein_coding | TCGA-DJ-A3VL-01 | Thyroid | thyroid carcinoma | Male | <65 | I/II | Unknown | Unknown | PD |
Page: 1 2 3 4 5 6 7 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
8493 | PPM1D | KINASE, SERINE THREONINE KINASE, ENZYME | DOXORUBICIN | DOXORUBICIN | 25466181 |
Page: 1 |