![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: CDK5RAP2 |
Gene summary for CDK5RAP2 |
![]() |
Gene information | Species | Human | Gene symbol | CDK5RAP2 | Gene ID | 55755 |
Gene name | CDK5 regulatory subunit associated protein 2 | |
Gene Alias | C48 | |
Cytomap | 9q33.2 | |
Gene Type | protein-coding | GO ID | GO:0000070 | UniProtAcc | B9EG74 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
55755 | CDK5RAP2 | CCI_2 | Human | Cervix | CC | 4.59e-04 | 7.11e-01 | 0.5249 |
55755 | CDK5RAP2 | CCI_3 | Human | Cervix | CC | 4.36e-14 | 9.14e-01 | 0.516 |
55755 | CDK5RAP2 | LZE2T | Human | Esophagus | ESCC | 2.31e-03 | 8.75e-01 | 0.082 |
55755 | CDK5RAP2 | LZE4T | Human | Esophagus | ESCC | 3.61e-19 | 1.50e+00 | 0.0811 |
55755 | CDK5RAP2 | LZE7T | Human | Esophagus | ESCC | 5.88e-10 | 4.21e-01 | 0.0667 |
55755 | CDK5RAP2 | LZE20T | Human | Esophagus | ESCC | 4.79e-04 | 1.96e-01 | 0.0662 |
55755 | CDK5RAP2 | LZE24T | Human | Esophagus | ESCC | 8.70e-05 | 8.03e-02 | 0.0596 |
55755 | CDK5RAP2 | LZE6T | Human | Esophagus | ESCC | 1.40e-04 | 1.80e-01 | 0.0845 |
55755 | CDK5RAP2 | P1T-E | Human | Esophagus | ESCC | 3.20e-07 | 4.08e-01 | 0.0875 |
55755 | CDK5RAP2 | P2T-E | Human | Esophagus | ESCC | 1.23e-29 | 4.69e-01 | 0.1177 |
55755 | CDK5RAP2 | P4T-E | Human | Esophagus | ESCC | 4.91e-11 | 2.67e-01 | 0.1323 |
55755 | CDK5RAP2 | P5T-E | Human | Esophagus | ESCC | 3.42e-07 | 1.04e-01 | 0.1327 |
55755 | CDK5RAP2 | P8T-E | Human | Esophagus | ESCC | 1.83e-11 | 1.77e-01 | 0.0889 |
55755 | CDK5RAP2 | P9T-E | Human | Esophagus | ESCC | 2.94e-33 | 8.40e-01 | 0.1131 |
55755 | CDK5RAP2 | P10T-E | Human | Esophagus | ESCC | 1.88e-13 | 1.71e-01 | 0.116 |
55755 | CDK5RAP2 | P11T-E | Human | Esophagus | ESCC | 1.61e-02 | 1.82e-01 | 0.1426 |
55755 | CDK5RAP2 | P12T-E | Human | Esophagus | ESCC | 2.34e-12 | 2.16e-01 | 0.1122 |
55755 | CDK5RAP2 | P15T-E | Human | Esophagus | ESCC | 2.51e-33 | 1.50e+00 | 0.1149 |
55755 | CDK5RAP2 | P16T-E | Human | Esophagus | ESCC | 2.91e-08 | 1.69e-01 | 0.1153 |
55755 | CDK5RAP2 | P17T-E | Human | Esophagus | ESCC | 9.69e-08 | 3.46e-01 | 0.1278 |
Page: 1 2 3 4 5 6 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00071639 | Cervix | CC | establishment or maintenance of cell polarity | 63/2311 | 218/18723 | 4.25e-11 | 8.76e-09 | 63 |
GO:190290310 | Cervix | CC | regulation of supramolecular fiber organization | 92/2311 | 383/18723 | 1.49e-10 | 2.48e-08 | 92 |
GO:004325410 | Cervix | CC | regulation of protein-containing complex assembly | 96/2311 | 428/18723 | 2.91e-09 | 3.05e-07 | 96 |
GO:00300108 | Cervix | CC | establishment of cell polarity | 42/2311 | 143/18723 | 4.30e-08 | 2.62e-06 | 42 |
GO:005125810 | Cervix | CC | protein polymerization | 70/2311 | 297/18723 | 5.20e-08 | 3.11e-06 | 70 |
GO:003227110 | Cervix | CC | regulation of protein polymerization | 57/2311 | 233/18723 | 2.37e-07 | 1.03e-05 | 57 |
GO:00447725 | Cervix | CC | mitotic cell cycle phase transition | 89/2311 | 424/18723 | 2.70e-07 | 1.12e-05 | 89 |
GO:003133410 | Cervix | CC | positive regulation of protein-containing complex assembly | 55/2311 | 237/18723 | 2.25e-06 | 6.73e-05 | 55 |
GO:190290510 | Cervix | CC | positive regulation of supramolecular fiber organization | 50/2311 | 209/18723 | 2.55e-06 | 7.54e-05 | 50 |
GO:00073466 | Cervix | CC | regulation of mitotic cell cycle | 88/2311 | 457/18723 | 1.26e-05 | 2.60e-04 | 88 |
GO:19019903 | Cervix | CC | regulation of mitotic cell cycle phase transition | 63/2311 | 299/18723 | 1.27e-05 | 2.60e-04 | 63 |
GO:005149510 | Cervix | CC | positive regulation of cytoskeleton organization | 50/2311 | 226/18723 | 2.53e-05 | 4.29e-04 | 50 |
GO:00516567 | Cervix | CC | establishment of organelle localization | 76/2311 | 390/18723 | 3.17e-05 | 5.21e-04 | 76 |
GO:00106399 | Cervix | CC | negative regulation of organelle organization | 68/2311 | 348/18723 | 7.40e-05 | 1.03e-03 | 68 |
GO:19019873 | Cervix | CC | regulation of cell cycle phase transition | 74/2311 | 390/18723 | 9.80e-05 | 1.27e-03 | 74 |
GO:003227310 | Cervix | CC | positive regulation of protein polymerization | 33/2311 | 138/18723 | 1.23e-04 | 1.53e-03 | 33 |
GO:00514948 | Cervix | CC | negative regulation of cytoskeleton organization | 37/2311 | 163/18723 | 1.57e-04 | 1.88e-03 | 37 |
GO:19021153 | Cervix | CC | regulation of organelle assembly | 40/2311 | 186/18723 | 2.92e-04 | 3.15e-03 | 40 |
GO:00705074 | Cervix | CC | regulation of microtubule cytoskeleton organization | 32/2311 | 148/18723 | 1.02e-03 | 8.51e-03 | 32 |
GO:00311134 | Cervix | CC | regulation of microtubule polymerization | 15/2311 | 55/18723 | 2.14e-03 | 1.54e-02 | 15 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
CDK5RAP2 | SNV | Missense_Mutation | c.5120N>A | p.Pro1707Gln | p.P1707Q | Q96SN8 | protein_coding | tolerated(0.13) | benign(0.339) | TCGA-G4-6628-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD | |
CDK5RAP2 | SNV | Missense_Mutation | rs754501128 | c.4805N>A | p.Arg1602His | p.R1602H | Q96SN8 | protein_coding | deleterious(0) | possibly_damaging(0.765) | TCGA-AG-A002-01 | Colorectum | rectum adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | SD |
CDK5RAP2 | SNV | Missense_Mutation | c.2155N>A | p.Asp719Asn | p.D719N | Q96SN8 | protein_coding | tolerated(0.19) | possibly_damaging(0.521) | TCGA-DY-A0XA-01 | Colorectum | rectum adenocarcinoma | Female | <65 | I/II | Chemotherapy | mayo | CR | |
CDK5RAP2 | SNV | Missense_Mutation | c.4913N>A | p.Ala1638Asp | p.A1638D | Q96SN8 | protein_coding | tolerated(0.11) | benign(0.116) | TCGA-EI-6882-01 | Colorectum | rectum adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | SD | |
CDK5RAP2 | SNV | Missense_Mutation | novel | c.5511N>T | p.Lys1837Asn | p.K1837N | Q96SN8 | protein_coding | deleterious(0.01) | possibly_damaging(0.902) | TCGA-F5-6814-01 | Colorectum | rectum adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | SD |
CDK5RAP2 | deletion | Frame_Shift_Del | c.998delN | p.Lys333ArgfsTer76 | p.K333Rfs*76 | Q96SN8 | protein_coding | TCGA-A6-5665-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | PD | |||
CDK5RAP2 | deletion | Frame_Shift_Del | c.3035delC | p.Pro1012LeufsTer62 | p.P1012Lfs*62 | Q96SN8 | protein_coding | TCGA-AD-5900-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD | |||
CDK5RAP2 | insertion | Frame_Shift_Ins | novel | c.2237_2238insA | p.Asn746LysfsTer10 | p.N746Kfs*10 | Q96SN8 | protein_coding | TCGA-CM-5861-01 | Colorectum | colon adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | PD | ||
CDK5RAP2 | deletion | Frame_Shift_Del | c.1356_1359delNNNN | p.Glu454LysfsTer11 | p.E454Kfs*11 | Q96SN8 | protein_coding | TCGA-CM-6674-01 | Colorectum | colon adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | SD | |||
CDK5RAP2 | insertion | Nonsense_Mutation | novel | c.664_694dupCTGATTGAGGAGTTGAAGCTGTCTTTGAAGA | p.Ser232ThrfsTer3 | p.S232Tfs*3 | Q96SN8 | protein_coding | TCGA-D5-6532-01 | Colorectum | colon adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |