Tissue | Expression Dynamics | Abbreviation |
Colorectum (GSE201348) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Becker/AP3D1_pca_on_diff_genes.png) | FAP: Familial adenomatous polyposis |
CRC: Colorectal cancer |
Colorectum (HTA11) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Chen/AP3D1_pca_on_diff_genes.png) | AD: Adenomas |
SER: Sessile serrated lesions |
MSI-H: Microsatellite-high colorectal cancer |
MSS: Microsatellite stable colorectal cancer |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/AP3D1_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Liver/AP3D1_pca_on_diff_genes.png) | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/AP3D1_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Prostate | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Prostate/AP3D1_pca_on_diff_genes.png) | BPH: Benign Prostatic Hyperplasia |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/AP3D1_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/AP3D1_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:0072594 | Colorectum | AD | establishment of protein localization to organelle | 148/3918 | 422/18723 | 7.95e-12 | 1.04e-09 | 148 |
GO:0048193 | Colorectum | AD | Golgi vesicle transport | 109/3918 | 296/18723 | 1.80e-10 | 1.68e-08 | 109 |
GO:0016197 | Colorectum | AD | endosomal transport | 90/3918 | 230/18723 | 1.88e-10 | 1.73e-08 | 90 |
GO:0051656 | Colorectum | AD | establishment of organelle localization | 131/3918 | 390/18723 | 3.00e-09 | 2.06e-07 | 131 |
GO:0006900 | Colorectum | AD | vesicle budding from membrane | 32/3918 | 61/18723 | 5.38e-08 | 2.81e-06 | 32 |
GO:0006605 | Colorectum | AD | protein targeting | 105/3918 | 314/18723 | 1.39e-07 | 6.44e-06 | 105 |
GO:0016050 | Colorectum | AD | vesicle organization | 101/3918 | 300/18723 | 1.65e-07 | 7.17e-06 | 101 |
GO:0006892 | Colorectum | AD | post-Golgi vesicle-mediated transport | 45/3918 | 104/18723 | 2.22e-07 | 9.26e-06 | 45 |
GO:0007034 | Colorectum | AD | vacuolar transport | 60/3918 | 157/18723 | 4.97e-07 | 1.85e-05 | 60 |
GO:0055076 | Colorectum | AD | transition metal ion homeostasis | 53/3918 | 138/18723 | 1.89e-06 | 5.65e-05 | 53 |
GO:0051650 | Colorectum | AD | establishment of vesicle localization | 57/3918 | 161/18723 | 1.47e-05 | 3.15e-04 | 57 |
GO:0046916 | Colorectum | AD | cellular transition metal ion homeostasis | 43/3918 | 115/18723 | 3.62e-05 | 6.56e-04 | 43 |
GO:0007041 | Colorectum | AD | lysosomal transport | 42/3918 | 114/18723 | 6.61e-05 | 1.07e-03 | 42 |
GO:0051648 | Colorectum | AD | vesicle localization | 59/3918 | 177/18723 | 7.83e-05 | 1.25e-03 | 59 |
GO:0072665 | Colorectum | AD | protein localization to vacuole | 27/3918 | 67/18723 | 2.40e-04 | 3.04e-03 | 27 |
GO:0045785 | Colorectum | AD | positive regulation of cell adhesion | 122/3918 | 437/18723 | 2.65e-04 | 3.28e-03 | 122 |
GO:0055069 | Colorectum | AD | zinc ion homeostasis | 18/3918 | 40/18723 | 5.36e-04 | 5.74e-03 | 18 |
GO:0030705 | Colorectum | AD | cytoskeleton-dependent intracellular transport | 60/3918 | 195/18723 | 7.56e-04 | 7.59e-03 | 60 |
GO:0006882 | Colorectum | AD | cellular zinc ion homeostasis | 17/3918 | 38/18723 | 8.26e-04 | 8.13e-03 | 17 |
GO:0061462 | Colorectum | AD | protein localization to lysosome | 19/3918 | 46/18723 | 1.36e-03 | 1.19e-02 | 19 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
AP3D1 | SNV | Missense_Mutation | novel | c.2987C>T | p.Thr996Ile | p.T996I | O14617 | protein_coding | tolerated(0.05) | benign(0.149) | TCGA-EO-A22U-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
AP3D1 | SNV | Missense_Mutation | novel | c.2063C>T | p.Ser688Leu | p.S688L | O14617 | protein_coding | deleterious(0.01) | possibly_damaging(0.506) | TCGA-EY-A1GK-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
AP3D1 | SNV | Missense_Mutation | novel | c.1355N>A | p.Arg452His | p.R452H | O14617 | protein_coding | deleterious(0) | probably_damaging(0.966) | TCGA-FI-A2D0-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
AP3D1 | SNV | Missense_Mutation | rs140333505 | c.289N>A | p.Ala97Thr | p.A97T | O14617 | protein_coding | deleterious(0.02) | probably_damaging(0.998) | TCGA-FI-A2D0-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
AP3D1 | SNV | Missense_Mutation | rs758018772 | c.1591N>A | p.Ala531Thr | p.A531T | O14617 | protein_coding | tolerated(0.1) | possibly_damaging(0.776) | TCGA-FI-A2D5-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Chemotherapy | carboplatinum | PD |
AP3D1 | SNV | Missense_Mutation | | c.1411N>C | p.Ser471Arg | p.S471R | O14617 | protein_coding | deleterious(0.03) | possibly_damaging(0.563) | TCGA-CC-A123-01 | Liver | liver hepatocellular carcinoma | Female | <65 | III/IV | Unknown | Unknown | PD |
AP3D1 | SNV | Missense_Mutation | novel | c.272A>T | p.Lys91Met | p.K91M | O14617 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-DD-AACK-01 | Liver | liver hepatocellular carcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
AP3D1 | SNV | Missense_Mutation | | c.211N>A | p.Asp71Asn | p.D71N | O14617 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-WJ-A86L-01 | Liver | liver hepatocellular carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
AP3D1 | deletion | In_Frame_Del | novel | c.319_339delGACGTCATCATGCTGACCACC | p.Asp107_Thr113del | p.D107_T113del | O14617 | protein_coding | | | TCGA-DD-AACP-01 | Liver | liver hepatocellular carcinoma | Male | <65 | I/II | Unknown | Unknown | SD |
AP3D1 | SNV | Missense_Mutation | novel | c.1318N>A | p.Gln440Lys | p.Q440K | O14617 | protein_coding | deleterious(0.03) | probably_damaging(0.979) | TCGA-05-4396-01 | Lung | lung adenocarcinoma | Male | >=65 | III/IV | Unknown | Unknown | SD |