|
Gene: ZNF3 |
Gene summary for ZNF3 |
Gene summary. |
Gene information | Species | Human | Gene symbol | ZNF3 | Gene ID | 7551 |
Gene name | zinc finger protein 3 | |
Gene Alias | A8-51 | |
Cytomap | 7q22.1 | |
Gene Type | protein-coding | GO ID | GO:0000122 | UniProtAcc | P17036 |
Top |
Malignant transformation analysis |
Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
Malignant transformation involving gene list. |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
7551 | ZNF3 | LZE7T | Human | Esophagus | ESCC | 1.22e-02 | 2.54e-01 | 0.0667 |
7551 | ZNF3 | LZE20T | Human | Esophagus | ESCC | 8.69e-06 | 1.93e-01 | 0.0662 |
7551 | ZNF3 | LZE22T | Human | Esophagus | ESCC | 3.38e-05 | 3.93e-01 | 0.068 |
7551 | ZNF3 | LZE24T | Human | Esophagus | ESCC | 2.72e-11 | 2.95e-01 | 0.0596 |
7551 | ZNF3 | P1T-E | Human | Esophagus | ESCC | 8.00e-06 | 3.01e-01 | 0.0875 |
7551 | ZNF3 | P2T-E | Human | Esophagus | ESCC | 4.88e-33 | 5.73e-01 | 0.1177 |
7551 | ZNF3 | P4T-E | Human | Esophagus | ESCC | 1.76e-13 | 3.04e-01 | 0.1323 |
7551 | ZNF3 | P5T-E | Human | Esophagus | ESCC | 1.59e-09 | 9.91e-02 | 0.1327 |
7551 | ZNF3 | P8T-E | Human | Esophagus | ESCC | 1.99e-27 | 2.50e-01 | 0.0889 |
7551 | ZNF3 | P9T-E | Human | Esophagus | ESCC | 5.88e-13 | 3.03e-01 | 0.1131 |
7551 | ZNF3 | P10T-E | Human | Esophagus | ESCC | 1.48e-35 | 5.92e-01 | 0.116 |
7551 | ZNF3 | P11T-E | Human | Esophagus | ESCC | 1.47e-12 | 4.91e-01 | 0.1426 |
7551 | ZNF3 | P12T-E | Human | Esophagus | ESCC | 2.39e-35 | 6.93e-01 | 0.1122 |
7551 | ZNF3 | P15T-E | Human | Esophagus | ESCC | 1.73e-29 | 6.51e-01 | 0.1149 |
7551 | ZNF3 | P16T-E | Human | Esophagus | ESCC | 1.20e-52 | 8.99e-01 | 0.1153 |
7551 | ZNF3 | P17T-E | Human | Esophagus | ESCC | 1.15e-06 | 3.54e-01 | 0.1278 |
7551 | ZNF3 | P20T-E | Human | Esophagus | ESCC | 3.54e-32 | 7.22e-01 | 0.1124 |
7551 | ZNF3 | P21T-E | Human | Esophagus | ESCC | 1.88e-16 | 2.43e-01 | 0.1617 |
7551 | ZNF3 | P22T-E | Human | Esophagus | ESCC | 1.07e-17 | 2.77e-01 | 0.1236 |
7551 | ZNF3 | P23T-E | Human | Esophagus | ESCC | 1.36e-24 | 6.31e-01 | 0.108 |
Page: 1 2 3 4 |
Transcriptomic changes along malignancy continuum. |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
Figure of enriched GO biological processes. |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | |
Colorectum | SER | |
Colorectum | MSS | |
Colorectum | MSI-H | |
Colorectum | FAP |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
Enriched GO biological processes. |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:000218127 | Esophagus | HGIN | cytoplasmic translation | 108/2587 | 148/18723 | 1.70e-60 | 1.02e-56 | 108 |
GO:000641727 | Esophagus | HGIN | regulation of translation | 139/2587 | 468/18723 | 1.46e-19 | 7.98e-17 | 139 |
GO:009719327 | Esophagus | HGIN | intrinsic apoptotic signaling pathway | 90/2587 | 288/18723 | 1.50e-14 | 2.80e-12 | 90 |
GO:200124227 | Esophagus | HGIN | regulation of intrinsic apoptotic signaling pathway | 58/2587 | 164/18723 | 2.57e-12 | 3.58e-10 | 58 |
GO:000640320 | Esophagus | HGIN | RNA localization | 66/2587 | 201/18723 | 4.06e-12 | 5.41e-10 | 66 |
GO:200123327 | Esophagus | HGIN | regulation of apoptotic signaling pathway | 97/2587 | 356/18723 | 1.36e-11 | 1.57e-09 | 97 |
GO:007233127 | Esophagus | HGIN | signal transduction by p53 class mediator | 49/2587 | 163/18723 | 5.71e-08 | 3.06e-06 | 49 |
GO:200123427 | Esophagus | HGIN | negative regulation of apoptotic signaling pathway | 59/2587 | 224/18723 | 4.68e-07 | 2.07e-05 | 59 |
GO:200124325 | Esophagus | HGIN | negative regulation of intrinsic apoptotic signaling pathway | 33/2587 | 98/18723 | 4.73e-07 | 2.07e-05 | 33 |
GO:00198277 | Esophagus | HGIN | stem cell population maintenance | 39/2587 | 131/18723 | 1.63e-06 | 6.14e-05 | 39 |
GO:00987278 | Esophagus | HGIN | maintenance of cell number | 39/2587 | 134/18723 | 3.02e-06 | 1.03e-04 | 39 |
GO:007233220 | Esophagus | HGIN | intrinsic apoptotic signaling pathway by p53 class mediator | 26/2587 | 76/18723 | 5.43e-06 | 1.73e-04 | 26 |
GO:190179827 | Esophagus | HGIN | positive regulation of signal transduction by p53 class mediator | 13/2587 | 25/18723 | 6.62e-06 | 2.07e-04 | 13 |
GO:003009927 | Esophagus | HGIN | myeloid cell differentiation | 83/2587 | 381/18723 | 1.26e-05 | 3.52e-04 | 83 |
GO:003033020 | Esophagus | HGIN | DNA damage response, signal transduction by p53 class mediator | 24/2587 | 72/18723 | 2.03e-05 | 5.43e-04 | 24 |
GO:200102019 | Esophagus | HGIN | regulation of response to DNA damage stimulus | 52/2587 | 219/18723 | 5.00e-05 | 1.19e-03 | 52 |
GO:000863020 | Esophagus | HGIN | intrinsic apoptotic signaling pathway in response to DNA damage | 28/2587 | 99/18723 | 1.24e-04 | 2.54e-03 | 28 |
GO:190179627 | Esophagus | HGIN | regulation of signal transduction by p53 class mediator | 26/2587 | 93/18723 | 2.60e-04 | 4.55e-03 | 26 |
GO:004277120 | Esophagus | HGIN | intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator | 15/2587 | 43/18723 | 4.06e-04 | 6.15e-03 | 15 |
GO:00427708 | Esophagus | HGIN | signal transduction in response to DNA damage | 39/2587 | 172/18723 | 1.07e-03 | 1.32e-02 | 39 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 |
Enriched KEGG pathways. |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
Annotation of somatic variants for genes involved in malignant transformation |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ZNF3 | SNV | Missense_Mutation | novel | c.22N>A | p.Val8Ile | p.V8I | P17036 | protein_coding | tolerated_low_confidence(0.14) | benign(0) | TCGA-ZP-A9D1-01 | Liver | liver hepatocellular carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ZNF3 | deletion | Frame_Shift_Del | novel | c.613_634delTGTAGCAAGAGCTTTAATCGAA | p.Cys205LeufsTer213 | p.C205Lfs*213 | P17036 | protein_coding | TCGA-DD-AADM-01 | Liver | liver hepatocellular carcinoma | Male | <65 | I/II | Unknown | Unknown | SD | ||
ZNF3 | SNV | Missense_Mutation | novel | c.101N>T | p.Gly34Val | p.G34V | P17036 | protein_coding | tolerated(0.05) | probably_damaging(0.973) | TCGA-05-4396-01 | Lung | lung adenocarcinoma | Male | >=65 | III/IV | Unknown | Unknown | SD |
ZNF3 | SNV | Missense_Mutation | c.323C>T | p.Ser108Leu | p.S108L | P17036 | protein_coding | tolerated(0.22) | benign(0) | TCGA-86-7954-01 | Lung | lung adenocarcinoma | Female | >=65 | I/II | Chemotherapy | carboplatin | CR | |
ZNF3 | SNV | Missense_Mutation | novel | c.569N>G | p.His190Arg | p.H190R | P17036 | protein_coding | deleterious(0) | possibly_damaging(0.904) | TCGA-86-8673-01 | Lung | lung adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | PD |
ZNF3 | SNV | Missense_Mutation | c.618C>G | p.Ser206Arg | p.S206R | P17036 | protein_coding | deleterious(0) | possibly_damaging(0.765) | TCGA-22-5471-01 | Lung | lung squamous cell carcinoma | Male | >=65 | I/II | Unknown | Unknown | PD | |
ZNF3 | SNV | Missense_Mutation | c.1252N>A | p.His418Asn | p.H418N | P17036 | protein_coding | deleterious(0) | probably_damaging(0.995) | TCGA-33-4566-01 | Lung | lung squamous cell carcinoma | Male | <65 | I/II | Unknown | Unknown | SD | |
ZNF3 | SNV | Missense_Mutation | c.661N>G | p.Ile221Val | p.I221V | P17036 | protein_coding | tolerated(0.13) | benign(0.268) | TCGA-34-5234-01 | Lung | lung squamous cell carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
ZNF3 | SNV | Missense_Mutation | c.1252N>T | p.His418Tyr | p.H418Y | P17036 | protein_coding | deleterious(0) | probably_damaging(0.995) | TCGA-52-7810-01 | Lung | lung squamous cell carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |
ZNF3 | SNV | Missense_Mutation | c.1028N>G | p.Asn343Ser | p.N343S | P17036 | protein_coding | tolerated(0.25) | benign(0.159) | TCGA-56-5897-01 | Lung | lung squamous cell carcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 |
Top |
Related drugs of malignant transformation related genes |
Identification of chemicals and drugs interact with genes involved in malignant transfromation |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |