Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: ZNF3

Gene summary for ZNF3

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

ZNF3

Gene ID

7551

Gene namezinc finger protein 3
Gene AliasA8-51
Cytomap7q22.1
Gene Typeprotein-coding
GO ID

GO:0000122

UniProtAcc

P17036


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
7551ZNF3LZE7THumanEsophagusESCC1.22e-022.54e-010.0667
7551ZNF3LZE20THumanEsophagusESCC8.69e-061.93e-010.0662
7551ZNF3LZE22THumanEsophagusESCC3.38e-053.93e-010.068
7551ZNF3LZE24THumanEsophagusESCC2.72e-112.95e-010.0596
7551ZNF3P1T-EHumanEsophagusESCC8.00e-063.01e-010.0875
7551ZNF3P2T-EHumanEsophagusESCC4.88e-335.73e-010.1177
7551ZNF3P4T-EHumanEsophagusESCC1.76e-133.04e-010.1323
7551ZNF3P5T-EHumanEsophagusESCC1.59e-099.91e-020.1327
7551ZNF3P8T-EHumanEsophagusESCC1.99e-272.50e-010.0889
7551ZNF3P9T-EHumanEsophagusESCC5.88e-133.03e-010.1131
7551ZNF3P10T-EHumanEsophagusESCC1.48e-355.92e-010.116
7551ZNF3P11T-EHumanEsophagusESCC1.47e-124.91e-010.1426
7551ZNF3P12T-EHumanEsophagusESCC2.39e-356.93e-010.1122
7551ZNF3P15T-EHumanEsophagusESCC1.73e-296.51e-010.1149
7551ZNF3P16T-EHumanEsophagusESCC1.20e-528.99e-010.1153
7551ZNF3P17T-EHumanEsophagusESCC1.15e-063.54e-010.1278
7551ZNF3P20T-EHumanEsophagusESCC3.54e-327.22e-010.1124
7551ZNF3P21T-EHumanEsophagusESCC1.88e-162.43e-010.1617
7551ZNF3P22T-EHumanEsophagusESCC1.07e-172.77e-010.1236
7551ZNF3P23T-EHumanEsophagusESCC1.36e-246.31e-010.108
Page: 1 2 3 4 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
LiverThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.HCC: Hepatocellular carcinoma
NAFLD: Non-alcoholic fatty liver disease
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:000218127EsophagusHGINcytoplasmic translation108/2587148/187231.70e-601.02e-56108
GO:000641727EsophagusHGINregulation of translation139/2587468/187231.46e-197.98e-17139
GO:009719327EsophagusHGINintrinsic apoptotic signaling pathway90/2587288/187231.50e-142.80e-1290
GO:200124227EsophagusHGINregulation of intrinsic apoptotic signaling pathway58/2587164/187232.57e-123.58e-1058
GO:000640320EsophagusHGINRNA localization66/2587201/187234.06e-125.41e-1066
GO:200123327EsophagusHGINregulation of apoptotic signaling pathway97/2587356/187231.36e-111.57e-0997
GO:007233127EsophagusHGINsignal transduction by p53 class mediator49/2587163/187235.71e-083.06e-0649
GO:200123427EsophagusHGINnegative regulation of apoptotic signaling pathway59/2587224/187234.68e-072.07e-0559
GO:200124325EsophagusHGINnegative regulation of intrinsic apoptotic signaling pathway33/258798/187234.73e-072.07e-0533
GO:00198277EsophagusHGINstem cell population maintenance39/2587131/187231.63e-066.14e-0539
GO:00987278EsophagusHGINmaintenance of cell number39/2587134/187233.02e-061.03e-0439
GO:007233220EsophagusHGINintrinsic apoptotic signaling pathway by p53 class mediator26/258776/187235.43e-061.73e-0426
GO:190179827EsophagusHGINpositive regulation of signal transduction by p53 class mediator13/258725/187236.62e-062.07e-0413
GO:003009927EsophagusHGINmyeloid cell differentiation83/2587381/187231.26e-053.52e-0483
GO:003033020EsophagusHGINDNA damage response, signal transduction by p53 class mediator24/258772/187232.03e-055.43e-0424
GO:200102019EsophagusHGINregulation of response to DNA damage stimulus52/2587219/187235.00e-051.19e-0352
GO:000863020EsophagusHGINintrinsic apoptotic signaling pathway in response to DNA damage28/258799/187231.24e-042.54e-0328
GO:190179627EsophagusHGINregulation of signal transduction by p53 class mediator26/258793/187232.60e-044.55e-0326
GO:004277120EsophagusHGINintrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator15/258743/187234.06e-046.15e-0315
GO:00427708EsophagusHGINsignal transduction in response to DNA damage39/2587172/187231.07e-031.32e-0239
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
ZNF3SNVMissense_Mutationnovelc.22N>Ap.Val8Ilep.V8IP17036protein_codingtolerated_low_confidence(0.14)benign(0)TCGA-ZP-A9D1-01Liverliver hepatocellular carcinomaFemale<65I/IIUnknownUnknownSD
ZNF3deletionFrame_Shift_Delnovelc.613_634delTGTAGCAAGAGCTTTAATCGAAp.Cys205LeufsTer213p.C205Lfs*213P17036protein_codingTCGA-DD-AADM-01Liverliver hepatocellular carcinomaMale<65I/IIUnknownUnknownSD
ZNF3SNVMissense_Mutationnovelc.101N>Tp.Gly34Valp.G34VP17036protein_codingtolerated(0.05)probably_damaging(0.973)TCGA-05-4396-01Lunglung adenocarcinomaMale>=65III/IVUnknownUnknownSD
ZNF3SNVMissense_Mutationc.323C>Tp.Ser108Leup.S108LP17036protein_codingtolerated(0.22)benign(0)TCGA-86-7954-01Lunglung adenocarcinomaFemale>=65I/IIChemotherapycarboplatinCR
ZNF3SNVMissense_Mutationnovelc.569N>Gp.His190Argp.H190RP17036protein_codingdeleterious(0)possibly_damaging(0.904)TCGA-86-8673-01Lunglung adenocarcinomaMale<65I/IIUnknownUnknownPD
ZNF3SNVMissense_Mutationc.618C>Gp.Ser206Argp.S206RP17036protein_codingdeleterious(0)possibly_damaging(0.765)TCGA-22-5471-01Lunglung squamous cell carcinomaMale>=65I/IIUnknownUnknownPD
ZNF3SNVMissense_Mutationc.1252N>Ap.His418Asnp.H418NP17036protein_codingdeleterious(0)probably_damaging(0.995)TCGA-33-4566-01Lunglung squamous cell carcinomaMale<65I/IIUnknownUnknownSD
ZNF3SNVMissense_Mutationc.661N>Gp.Ile221Valp.I221VP17036protein_codingtolerated(0.13)benign(0.268)TCGA-34-5234-01Lunglung squamous cell carcinomaFemale>=65I/IIUnknownUnknownSD
ZNF3SNVMissense_Mutationc.1252N>Tp.His418Tyrp.H418YP17036protein_codingdeleterious(0)probably_damaging(0.995)TCGA-52-7810-01Lunglung squamous cell carcinomaFemale<65I/IIUnknownUnknownSD
ZNF3SNVMissense_Mutationc.1028N>Gp.Asn343Serp.N343SP17036protein_codingtolerated(0.25)benign(0.159)TCGA-56-5897-01Lunglung squamous cell carcinomaMale>=65I/IIUnknownUnknownSD
Page: 1 2 3 4 5 6 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1