Tissue | Expression Dynamics | Abbreviation |
Colorectum (GSE201348) | | FAP: Familial adenomatous polyposis |
CRC: Colorectal cancer |
Colorectum (HTA11) | | AD: Adenomas |
SER: Sessile serrated lesions |
MSI-H: Microsatellite-high colorectal cancer |
MSS: Microsatellite stable colorectal cancer |
Esophagus | | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Oral Cavity | | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:0031667 | Colorectum | AD | response to nutrient levels | 138/3918 | 474/18723 | 1.22e-05 | 2.68e-04 | 138 |
GO:0042594 | Colorectum | AD | response to starvation | 63/3918 | 197/18723 | 1.77e-04 | 2.38e-03 | 63 |
GO:0071496 | Colorectum | AD | cellular response to external stimulus | 94/3918 | 320/18723 | 1.98e-04 | 2.64e-03 | 94 |
GO:0009267 | Colorectum | AD | cellular response to starvation | 51/3918 | 156/18723 | 3.90e-04 | 4.44e-03 | 51 |
GO:0031668 | Colorectum | AD | cellular response to extracellular stimulus | 71/3918 | 246/18723 | 1.86e-03 | 1.52e-02 | 71 |
GO:0031669 | Colorectum | AD | cellular response to nutrient levels | 63/3918 | 215/18723 | 2.19e-03 | 1.73e-02 | 63 |
GO:0071496111 | Esophagus | ESCC | cellular response to external stimulus | 215/8552 | 320/18723 | 4.29e-15 | 2.43e-13 | 215 |
GO:0031668111 | Esophagus | ESCC | cellular response to extracellular stimulus | 168/8552 | 246/18723 | 4.93e-13 | 2.23e-11 | 168 |
GO:0031669110 | Esophagus | ESCC | cellular response to nutrient levels | 148/8552 | 215/18723 | 4.58e-12 | 1.76e-10 | 148 |
GO:0031667111 | Esophagus | ESCC | response to nutrient levels | 289/8552 | 474/18723 | 9.25e-12 | 3.47e-10 | 289 |
GO:0009267110 | Esophagus | ESCC | cellular response to starvation | 110/8552 | 156/18723 | 2.63e-10 | 7.37e-09 | 110 |
GO:004259419 | Esophagus | ESCC | response to starvation | 133/8552 | 197/18723 | 4.31e-10 | 1.14e-08 | 133 |
GO:00421492 | Esophagus | ESCC | cellular response to glucose starvation | 36/8552 | 48/18723 | 3.43e-05 | 2.80e-04 | 36 |
GO:007149620 | Oral cavity | OSCC | cellular response to external stimulus | 186/7305 | 320/18723 | 2.56e-12 | 1.05e-10 | 186 |
GO:003166819 | Oral cavity | OSCC | cellular response to extracellular stimulus | 141/7305 | 246/18723 | 3.99e-09 | 8.95e-08 | 141 |
GO:003166720 | Oral cavity | OSCC | response to nutrient levels | 245/7305 | 474/18723 | 1.02e-08 | 2.10e-07 | 245 |
GO:003166918 | Oral cavity | OSCC | cellular response to nutrient levels | 121/7305 | 215/18723 | 1.96e-07 | 3.17e-06 | 121 |
GO:004259416 | Oral cavity | OSCC | response to starvation | 111/7305 | 197/18723 | 5.68e-07 | 8.19e-06 | 111 |
GO:000926717 | Oral cavity | OSCC | cellular response to starvation | 91/7305 | 156/18723 | 7.55e-07 | 1.06e-05 | 91 |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
NUAK2 | GRA | Oral cavity | ADJ | TGM1,EVPL,ANXA1, etc. | 2.46e-01 | |
NUAK2 | COR | Oral cavity | LP | TGM1,EVPL,ANXA1, etc. | 2.21e-01 | |
NUAK2 | GRA | Oral cavity | LP | TGM1,EVPL,ANXA1, etc. | 2.46e-01 | |
NUAK2 | COR | Oral cavity | OSCC | TGM1,EVPL,ANXA1, etc. | 3.81e-01 | |
NUAK2 | ECC | Skin | AK | LGALSL,CALML5,SLURP1, etc. | 4.91e-02 | |
NUAK2 | PIL | Skin | SCCIS | LGALSL,CALML5,SLURP1, etc. | 1.34e-02 | |
NUAK2 | cDC | Skin | ADJ | BIRC3,CCR7,MARCKSL1, etc. | 1.51e-01 | |
NUAK2 | PLA | Skin | ADJ | BIRC3,CCR7,MARCKSL1, etc. | 1.36e-02 | |
NUAK2 | cDC | Skin | AK | BIRC3,CCR7,MARCKSL1, etc. | 1.44e-01 | |
NUAK2 | PLA | Skin | AK | BIRC3,CCR7,MARCKSL1, etc. | 2.49e-02 | |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
NUAK2 | SNV | Missense_Mutation | rs561905076 | c.1837N>T | p.Arg613Trp | p.R613W | Q9H093 | protein_coding | deleterious(0.01) | probably_damaging(0.998) | TCGA-EY-A548-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
NUAK2 | SNV | Missense_Mutation | novel | c.262N>A | p.His88Asn | p.H88N | Q9H093 | protein_coding | tolerated(0.1) | benign(0.069) | TCGA-FI-A2D6-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
NUAK2 | insertion | Frame_Shift_Ins | novel | c.960_961insC | p.Cys321LeufsTer43 | p.C321Lfs*43 | Q9H093 | protein_coding | | | TCGA-D1-A175-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Chemotherapy | paclitaxel | SD |
NUAK2 | deletion | Frame_Shift_Del | rs753375361 | c.1456delN | p.Leu486CysfsTer38 | p.L486Cfs*38 | Q9H093 | protein_coding | | | TCGA-EC-A1QX-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Chemotherapy | cyclophosphamide | PD |
NUAK2 | SNV | Missense_Mutation | | c.1924N>C | p.Asp642His | p.D642H | Q9H093 | protein_coding | tolerated_low_confidence(0.05) | benign(0.275) | TCGA-CC-5264-01 | Liver | liver hepatocellular carcinoma | Male | >=65 | III/IV | Unknown | Unknown | SD |
NUAK2 | deletion | In_Frame_Del | novel | c.263_286delACCACAAGCACAACCTGCGGCACC | p.His88_His95del | p.H88_H95del | Q9H093 | protein_coding | | | TCGA-5C-A9VH-01 | Liver | liver hepatocellular carcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
NUAK2 | SNV | Missense_Mutation | novel | c.1773C>A | p.Ser591Arg | p.S591R | Q9H093 | protein_coding | deleterious(0) | probably_damaging(0.996) | TCGA-55-7907-01 | Lung | lung adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | PD |
NUAK2 | SNV | Missense_Mutation | rs765807541 | c.974N>T | p.Arg325Leu | p.R325L | Q9H093 | protein_coding | deleterious(0) | probably_damaging(0.992) | TCGA-55-7994-01 | Lung | lung adenocarcinoma | Male | >=65 | I/II | Chemotherapy | carboplatin | CR |
NUAK2 | SNV | Missense_Mutation | | c.181G>C | p.Ala61Pro | p.A61P | Q9H093 | protein_coding | deleterious_low_confidence(0.01) | benign(0.053) | TCGA-64-1676-01 | Lung | lung adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | SD |
NUAK2 | SNV | Missense_Mutation | | c.1705N>A | p.Asp569Asn | p.D569N | Q9H093 | protein_coding | tolerated(0.09) | benign(0.028) | TCGA-18-3409-01 | Lung | lung squamous cell carcinoma | Male | >=65 | I/II | Unknown | Unknown | PD |