Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: NUAK2

Gene summary for NUAK2

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

NUAK2

Gene ID

81788

Gene nameNUAK family kinase 2
Gene AliasANPH2
Cytomap1q32.1
Gene Typeprotein-coding
GO ID

GO:0006464

UniProtAcc

B4E0Y5


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
81788NUAK2HTA11_347_2000001011HumanColorectumAD4.14e-072.39e-01-0.1954
81788NUAK2HTA11_1391_2000001011HumanColorectumAD2.73e-083.75e-01-0.059
81788NUAK2HTA11_546_2000001011HumanColorectumAD1.61e-043.31e-01-0.0842
81788NUAK2HTA11_866_3004761011HumanColorectumAD1.76e-083.23e-010.096
81788NUAK2LZE4THumanEsophagusESCC6.92e-104.40e-010.0811
81788NUAK2LZE20THumanEsophagusESCC2.06e-083.64e-010.0662
81788NUAK2LZE22THumanEsophagusESCC1.01e-034.64e-010.068
81788NUAK2LZE21THumanEsophagusESCC5.75e-053.18e-010.0655
81788NUAK2P1T-EHumanEsophagusESCC1.65e-199.96e-010.0875
81788NUAK2P2T-EHumanEsophagusESCC5.75e-133.39e-010.1177
81788NUAK2P4T-EHumanEsophagusESCC8.21e-205.29e-010.1323
81788NUAK2P5T-EHumanEsophagusESCC2.41e-348.13e-010.1327
81788NUAK2P8T-EHumanEsophagusESCC4.40e-102.37e-010.0889
81788NUAK2P9T-EHumanEsophagusESCC6.69e-051.76e-010.1131
81788NUAK2P10T-EHumanEsophagusESCC7.96e-036.94e-020.116
81788NUAK2P11T-EHumanEsophagusESCC1.98e-188.58e-010.1426
81788NUAK2P12T-EHumanEsophagusESCC2.74e-111.95e-010.1122
81788NUAK2P15T-EHumanEsophagusESCC3.87e-092.69e-010.1149
81788NUAK2P16T-EHumanEsophagusESCC1.21e-071.55e-010.1153
81788NUAK2P21T-EHumanEsophagusESCC9.02e-163.28e-010.1617
Page: 1 2 3 4 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
Colorectum (GSE201348)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.FAP: Familial adenomatous polyposis
CRC: Colorectal cancer
Colorectum (HTA11)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AD: Adenomas
SER: Sessile serrated lesions
MSI-H: Microsatellite-high colorectal cancer
MSS: Microsatellite stable colorectal cancer
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:0031667ColorectumADresponse to nutrient levels138/3918474/187231.22e-052.68e-04138
GO:0042594ColorectumADresponse to starvation63/3918197/187231.77e-042.38e-0363
GO:0071496ColorectumADcellular response to external stimulus94/3918320/187231.98e-042.64e-0394
GO:0009267ColorectumADcellular response to starvation51/3918156/187233.90e-044.44e-0351
GO:0031668ColorectumADcellular response to extracellular stimulus71/3918246/187231.86e-031.52e-0271
GO:0031669ColorectumADcellular response to nutrient levels63/3918215/187232.19e-031.73e-0263
GO:0071496111EsophagusESCCcellular response to external stimulus215/8552320/187234.29e-152.43e-13215
GO:0031668111EsophagusESCCcellular response to extracellular stimulus168/8552246/187234.93e-132.23e-11168
GO:0031669110EsophagusESCCcellular response to nutrient levels148/8552215/187234.58e-121.76e-10148
GO:0031667111EsophagusESCCresponse to nutrient levels289/8552474/187239.25e-123.47e-10289
GO:0009267110EsophagusESCCcellular response to starvation110/8552156/187232.63e-107.37e-09110
GO:004259419EsophagusESCCresponse to starvation133/8552197/187234.31e-101.14e-08133
GO:00421492EsophagusESCCcellular response to glucose starvation36/855248/187233.43e-052.80e-0436
GO:007149620Oral cavityOSCCcellular response to external stimulus186/7305320/187232.56e-121.05e-10186
GO:003166819Oral cavityOSCCcellular response to extracellular stimulus141/7305246/187233.99e-098.95e-08141
GO:003166720Oral cavityOSCCresponse to nutrient levels245/7305474/187231.02e-082.10e-07245
GO:003166918Oral cavityOSCCcellular response to nutrient levels121/7305215/187231.96e-073.17e-06121
GO:004259416Oral cavityOSCCresponse to starvation111/7305197/187235.68e-078.19e-06111
GO:000926717Oral cavityOSCCcellular response to starvation91/7305156/187237.55e-071.06e-0591
Page: 1 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
NUAK2GRAOral cavityADJTGM1,EVPL,ANXA1, etc.2.46e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
NUAK2COROral cavityLPTGM1,EVPL,ANXA1, etc.2.21e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
NUAK2GRAOral cavityLPTGM1,EVPL,ANXA1, etc.2.46e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
NUAK2COROral cavityOSCCTGM1,EVPL,ANXA1, etc.3.81e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
NUAK2ECCSkinAKLGALSL,CALML5,SLURP1, etc.4.91e-02The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
NUAK2PILSkinSCCISLGALSL,CALML5,SLURP1, etc.1.34e-02The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
NUAK2cDCSkinADJBIRC3,CCR7,MARCKSL1, etc.1.51e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
NUAK2PLASkinADJBIRC3,CCR7,MARCKSL1, etc.1.36e-02The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
NUAK2cDCSkinAKBIRC3,CCR7,MARCKSL1, etc.1.44e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
NUAK2PLASkinAKBIRC3,CCR7,MARCKSL1, etc.2.49e-02The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 2 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
NUAK2SNVMissense_Mutationrs561905076c.1837N>Tp.Arg613Trpp.R613WQ9H093protein_codingdeleterious(0.01)probably_damaging(0.998)TCGA-EY-A548-01Endometriumuterine corpus endometrioid carcinomaFemale>=65I/IIUnknownUnknownSD
NUAK2SNVMissense_Mutationnovelc.262N>Ap.His88Asnp.H88NQ9H093protein_codingtolerated(0.1)benign(0.069)TCGA-FI-A2D6-01Endometriumuterine corpus endometrioid carcinomaFemale>=65I/IIUnknownUnknownSD
NUAK2insertionFrame_Shift_Insnovelc.960_961insCp.Cys321LeufsTer43p.C321Lfs*43Q9H093protein_codingTCGA-D1-A175-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIChemotherapypaclitaxelSD
NUAK2deletionFrame_Shift_Delrs753375361c.1456delNp.Leu486CysfsTer38p.L486Cfs*38Q9H093protein_codingTCGA-EC-A1QX-01Endometriumuterine corpus endometrioid carcinomaFemale>=65I/IIChemotherapycyclophosphamidePD
NUAK2SNVMissense_Mutationc.1924N>Cp.Asp642Hisp.D642HQ9H093protein_codingtolerated_low_confidence(0.05)benign(0.275)TCGA-CC-5264-01Liverliver hepatocellular carcinomaMale>=65III/IVUnknownUnknownSD
NUAK2deletionIn_Frame_Delnovelc.263_286delACCACAAGCACAACCTGCGGCACCp.His88_His95delp.H88_H95delQ9H093protein_codingTCGA-5C-A9VH-01Liverliver hepatocellular carcinomaMale>=65I/IIUnknownUnknownSD
NUAK2SNVMissense_Mutationnovelc.1773C>Ap.Ser591Argp.S591RQ9H093protein_codingdeleterious(0)probably_damaging(0.996)TCGA-55-7907-01Lunglung adenocarcinomaMale>=65I/IIUnknownUnknownPD
NUAK2SNVMissense_Mutationrs765807541c.974N>Tp.Arg325Leup.R325LQ9H093protein_codingdeleterious(0)probably_damaging(0.992)TCGA-55-7994-01Lunglung adenocarcinomaMale>=65I/IIChemotherapycarboplatinCR
NUAK2SNVMissense_Mutationc.181G>Cp.Ala61Prop.A61PQ9H093protein_codingdeleterious_low_confidence(0.01)benign(0.053)TCGA-64-1676-01Lunglung adenocarcinomaMale<65I/IIUnknownUnknownSD
NUAK2SNVMissense_Mutationc.1705N>Ap.Asp569Asnp.D569NQ9H093protein_codingtolerated(0.09)benign(0.028)TCGA-18-3409-01Lunglung squamous cell carcinomaMale>=65I/IIUnknownUnknownPD
Page: 1 2 3 4 5 6 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
81788NUAK2KINASE, SERINE THREONINE KINASE, DRUGGABLE GENOME, ENZYMEinhibitor249565727
Page: 1