![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: TJP3 |
Gene summary for TJP3 |
![]() |
Gene information | Species | Human | Gene symbol | TJP3 | Gene ID | 27134 |
Gene name | tight junction protein 3 | |
Gene Alias | ZO-3 | |
Cytomap | 19p13.3 | |
Gene Type | protein-coding | GO ID | GO:0001885 | UniProtAcc | O95049 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
27134 | TJP3 | HTA11_2487_2000001011 | Human | Colorectum | SER | 3.31e-22 | 1.13e+00 | -0.1808 |
27134 | TJP3 | HTA11_1938_2000001011 | Human | Colorectum | AD | 1.86e-10 | 6.47e-01 | -0.0811 |
27134 | TJP3 | HTA11_78_2000001011 | Human | Colorectum | AD | 8.47e-07 | 4.87e-01 | -0.1088 |
27134 | TJP3 | HTA11_347_2000001011 | Human | Colorectum | AD | 6.53e-33 | 9.86e-01 | -0.1954 |
27134 | TJP3 | HTA11_411_2000001011 | Human | Colorectum | SER | 1.14e-09 | 1.94e+00 | -0.2602 |
27134 | TJP3 | HTA11_2112_2000001011 | Human | Colorectum | SER | 3.11e-15 | 1.43e+00 | -0.2196 |
27134 | TJP3 | HTA11_3361_2000001011 | Human | Colorectum | AD | 1.28e-18 | 9.65e-01 | -0.1207 |
27134 | TJP3 | HTA11_83_2000001011 | Human | Colorectum | SER | 4.54e-18 | 1.13e+00 | -0.1526 |
27134 | TJP3 | HTA11_696_2000001011 | Human | Colorectum | AD | 9.90e-35 | 1.23e+00 | -0.1464 |
27134 | TJP3 | HTA11_866_2000001011 | Human | Colorectum | AD | 3.19e-20 | 8.86e-01 | -0.1001 |
27134 | TJP3 | HTA11_1391_2000001011 | Human | Colorectum | AD | 4.07e-19 | 9.29e-01 | -0.059 |
27134 | TJP3 | HTA11_2992_2000001011 | Human | Colorectum | SER | 1.78e-10 | 1.09e+00 | -0.1706 |
27134 | TJP3 | HTA11_5212_2000001011 | Human | Colorectum | AD | 7.31e-09 | 8.81e-01 | -0.2061 |
27134 | TJP3 | HTA11_546_2000001011 | Human | Colorectum | AD | 4.08e-13 | 8.55e-01 | -0.0842 |
27134 | TJP3 | HTA11_866_3004761011 | Human | Colorectum | AD | 3.86e-03 | 3.18e-01 | 0.096 |
27134 | TJP3 | HTA11_7696_3000711011 | Human | Colorectum | AD | 4.65e-14 | 6.99e-01 | 0.0674 |
27134 | TJP3 | HTA11_6818_2000001011 | Human | Colorectum | AD | 3.42e-06 | 7.00e-01 | 0.0112 |
27134 | TJP3 | HTA11_99999971662_82457 | Human | Colorectum | MSS | 4.38e-02 | 3.96e-01 | 0.3859 |
27134 | TJP3 | A001-C-207 | Human | Colorectum | FAP | 4.17e-02 | -2.92e-01 | 0.1278 |
27134 | TJP3 | A015-C-203 | Human | Colorectum | FAP | 5.09e-15 | -2.64e-01 | -0.1294 |
Page: 1 2 3 4 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:0002064 | Colorectum | AD | epithelial cell development | 89/3918 | 220/18723 | 2.98e-11 | 3.52e-09 | 89 |
GO:0045216 | Colorectum | AD | cell-cell junction organization | 80/3918 | 200/18723 | 5.57e-10 | 4.58e-08 | 80 |
GO:0061028 | Colorectum | AD | establishment of endothelial barrier | 23/3918 | 46/18723 | 1.14e-05 | 2.57e-04 | 23 |
GO:0060249 | Colorectum | AD | anatomical structure homeostasis | 94/3918 | 314/18723 | 9.37e-05 | 1.42e-03 | 94 |
GO:0001894 | Colorectum | AD | tissue homeostasis | 81/3918 | 268/18723 | 1.96e-04 | 2.62e-03 | 81 |
GO:0001885 | Colorectum | AD | endothelial cell development | 26/3918 | 64/18723 | 2.67e-04 | 3.29e-03 | 26 |
GO:0090557 | Colorectum | AD | establishment of endothelial intestinal barrier | 8/3918 | 12/18723 | 7.99e-04 | 7.91e-03 | 8 |
GO:0003158 | Colorectum | AD | endothelium development | 44/3918 | 136/18723 | 1.20e-03 | 1.07e-02 | 44 |
GO:0045446 | Colorectum | AD | endothelial cell differentiation | 39/3918 | 118/18723 | 1.42e-03 | 1.22e-02 | 39 |
GO:0150105 | Colorectum | AD | protein localization to cell-cell junction | 11/3918 | 21/18723 | 1.43e-03 | 1.22e-02 | 11 |
GO:1902414 | Colorectum | AD | protein localization to cell junction | 31/3918 | 94/18723 | 4.30e-03 | 2.95e-02 | 31 |
GO:0035633 | Colorectum | AD | maintenance of blood-brain barrier | 14/3918 | 35/18723 | 7.92e-03 | 4.73e-02 | 14 |
GO:00452161 | Colorectum | SER | cell-cell junction organization | 63/2897 | 200/18723 | 9.15e-09 | 7.80e-07 | 63 |
GO:00020641 | Colorectum | SER | epithelial cell development | 64/2897 | 220/18723 | 1.96e-07 | 1.10e-05 | 64 |
GO:00018941 | Colorectum | SER | tissue homeostasis | 66/2897 | 268/18723 | 5.87e-05 | 1.37e-03 | 66 |
GO:00602491 | Colorectum | SER | anatomical structure homeostasis | 74/2897 | 314/18723 | 1.01e-04 | 2.13e-03 | 74 |
GO:00905571 | Colorectum | SER | establishment of endothelial intestinal barrier | 7/2897 | 12/18723 | 8.12e-04 | 1.01e-02 | 7 |
GO:00610281 | Colorectum | SER | establishment of endothelial barrier | 15/2897 | 46/18723 | 2.92e-03 | 2.59e-02 | 15 |
GO:00020642 | Colorectum | MSS | epithelial cell development | 81/3467 | 220/18723 | 1.02e-10 | 1.06e-08 | 81 |
GO:00452162 | Colorectum | MSS | cell-cell junction organization | 69/3467 | 200/18723 | 5.07e-08 | 2.70e-06 | 69 |
Page: 1 2 3 4 5 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa04530 | Colorectum | AD | Tight junction | 76/2092 | 169/8465 | 5.49e-09 | 9.69e-08 | 6.18e-08 | 76 |
hsa045301 | Colorectum | AD | Tight junction | 76/2092 | 169/8465 | 5.49e-09 | 9.69e-08 | 6.18e-08 | 76 |
hsa045302 | Colorectum | SER | Tight junction | 59/1580 | 169/8465 | 3.24e-07 | 5.98e-06 | 4.34e-06 | 59 |
hsa045303 | Colorectum | SER | Tight junction | 59/1580 | 169/8465 | 3.24e-07 | 5.98e-06 | 4.34e-06 | 59 |
hsa045304 | Colorectum | MSS | Tight junction | 66/1875 | 169/8465 | 4.10e-07 | 6.25e-06 | 3.83e-06 | 66 |
hsa045305 | Colorectum | MSS | Tight junction | 66/1875 | 169/8465 | 4.10e-07 | 6.25e-06 | 3.83e-06 | 66 |
hsa045308 | Colorectum | FAP | Tight junction | 60/1404 | 169/8465 | 1.40e-09 | 9.33e-08 | 5.67e-08 | 60 |
hsa045309 | Colorectum | FAP | Tight junction | 60/1404 | 169/8465 | 1.40e-09 | 9.33e-08 | 5.67e-08 | 60 |
hsa0453010 | Colorectum | CRC | Tight junction | 44/1091 | 169/8465 | 2.51e-06 | 7.61e-05 | 5.16e-05 | 44 |
hsa0453011 | Colorectum | CRC | Tight junction | 44/1091 | 169/8465 | 2.51e-06 | 7.61e-05 | 5.16e-05 | 44 |
hsa04530211 | Esophagus | ESCC | Tight junction | 105/4205 | 169/8465 | 6.73e-04 | 2.23e-03 | 1.14e-03 | 105 |
hsa04530310 | Esophagus | ESCC | Tight junction | 105/4205 | 169/8465 | 6.73e-04 | 2.23e-03 | 1.14e-03 | 105 |
hsa0453012 | Stomach | GC | Tight junction | 33/708 | 169/8465 | 3.03e-06 | 4.65e-05 | 3.28e-05 | 33 |
hsa0453013 | Stomach | GC | Tight junction | 33/708 | 169/8465 | 3.03e-06 | 4.65e-05 | 3.28e-05 | 33 |
hsa0453021 | Stomach | CAG with IM | Tight junction | 32/640 | 169/8465 | 9.69e-07 | 1.62e-05 | 1.14e-05 | 32 |
hsa0453031 | Stomach | CAG with IM | Tight junction | 32/640 | 169/8465 | 9.69e-07 | 1.62e-05 | 1.14e-05 | 32 |
hsa0453041 | Stomach | CSG | Tight junction | 31/633 | 169/8465 | 2.29e-06 | 3.45e-05 | 2.48e-05 | 31 |
hsa0453051 | Stomach | CSG | Tight junction | 31/633 | 169/8465 | 2.29e-06 | 3.45e-05 | 2.48e-05 | 31 |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
TJP3 | SNV | Missense_Mutation | rs749504969 | c.2470G>A | p.Ala824Thr | p.A824T | O95049 | protein_coding | tolerated(0.07) | benign(0.138) | TCGA-F5-6861-01 | Colorectum | rectum adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
TJP3 | insertion | Frame_Shift_Ins | rs772442867 | c.2504_2505insG | p.Pro838AlafsTer7 | p.P838Afs*7 | O95049 | protein_coding | TCGA-AZ-6598-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | ||
TJP3 | deletion | In_Frame_Del | c.2467_2490delGGCGCGTACACGGATGGCGAGGGC | p.Gly823_Gly830del | p.G823_G830del | O95049 | protein_coding | TCGA-CM-4750-01 | Colorectum | colon adenocarcinoma | Female | <65 | III/IV | Chemotherapy | fluorouracil | SD | |||
TJP3 | deletion | Frame_Shift_Del | c.1219delN | p.Gly408AlafsTer31 | p.G408Afs*31 | O95049 | protein_coding | TCGA-D5-6928-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD | |||
TJP3 | deletion | Frame_Shift_Del | rs748320679 | c.2505delN | p.Tyr839ThrfsTer64 | p.Y839Tfs*64 | O95049 | protein_coding | TCGA-WS-AB45-01 | Colorectum | colon adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
TJP3 | SNV | Missense_Mutation | novel | c.968G>A | p.Arg323Gln | p.R323Q | O95049 | protein_coding | tolerated(0.37) | benign(0.009) | TCGA-A5-A0G1-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
TJP3 | SNV | Missense_Mutation | novel | c.1139G>T | p.Ser380Ile | p.S380I | O95049 | protein_coding | deleterious(0.03) | benign(0.115) | TCGA-A5-A0G1-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
TJP3 | SNV | Missense_Mutation | novel | c.1139G>T | p.Ser380Ile | p.S380I | O95049 | protein_coding | deleterious(0.03) | benign(0.115) | TCGA-A5-A0GG-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
TJP3 | SNV | Missense_Mutation | rs541582766 | c.1169C>T | p.Thr390Met | p.T390M | O95049 | protein_coding | tolerated(0.48) | benign(0.3) | TCGA-A5-A0GG-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
TJP3 | SNV | Missense_Mutation | rs147001701 | c.1598N>T | p.Ala533Val | p.A533V | O95049 | protein_coding | deleterious(0.02) | benign(0.077) | TCGA-A5-A0R7-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 7 8 9 10 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |