![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: WDR17 |
Gene summary for WDR17 |
![]() |
Gene information | Species | Human | Gene symbol | WDR17 | Gene ID | 116966 |
Gene name | WD repeat domain 17 | |
Gene Alias | WDR17 | |
Cytomap | 4q34.2 | |
Gene Type | protein-coding | GO ID | NA | UniProtAcc | Q8IZU2 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
116966 | WDR17 | HCC1 | Human | Liver | HCC | 5.09e-09 | 8.86e-01 | 0.5336 |
116966 | WDR17 | HCC2 | Human | Liver | HCC | 1.41e-14 | 1.01e+00 | 0.5341 |
116966 | WDR17 | HCC5 | Human | Liver | HCC | 3.01e-14 | 8.14e-01 | 0.4932 |
116966 | WDR17 | HTA12-23-1 | Human | Pancreas | PDAC | 1.27e-03 | 6.03e-01 | 0.3405 |
116966 | WDR17 | HTA12-25-1 | Human | Pancreas | PDAC | 3.33e-03 | 4.07e-01 | 0.313 |
116966 | WDR17 | HTA12-26-1 | Human | Pancreas | PDAC | 2.63e-13 | 7.33e-01 | 0.3728 |
116966 | WDR17 | HTA12-29-1 | Human | Pancreas | PDAC | 9.44e-28 | 6.40e-01 | 0.3722 |
Page: 1 |
![]() |
Tissue | Expression Dynamics | Abbreviation |
Liver | ![]() | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
WDR17 | SNV | Missense_Mutation | rs753004304 | c.1096G>A | p.Val366Met | p.V366M | Q8IZU2 | protein_coding | deleterious(0) | possibly_damaging(0.646) | TCGA-VQ-A94T-01 | Stomach | stomach adenocarcinoma | Male | >=65 | III/IV | Unknown | Unknown | PD |
WDR17 | insertion | Frame_Shift_Ins | novel | c.977_978insA | p.Phe329ValfsTer50 | p.F329Vfs*50 | Q8IZU2 | protein_coding | TCGA-BR-8372-01 | Stomach | stomach adenocarcinoma | Male | <65 | III/IV | Chemotherapy | etoposide | CR | ||
WDR17 | deletion | Frame_Shift_Del | novel | c.3282_3318delTATATTTGAAACTGTAAAATATTACTTGTTAAGTCAA | p.Asn1094LysfsTer35 | p.N1094Kfs*35 | Q8IZU2 | protein_coding | TCGA-BR-A44U-01 | Stomach | stomach adenocarcinoma | Male | >=65 | III/IV | Unknown | Unknown | SD | ||
WDR17 | insertion | In_Frame_Ins | novel | c.2494_2495insAAGAAAATAGAA | p.Gln831_Ile832insLysGluAsnArg | p.Q831_I832insKENR | Q8IZU2 | protein_coding | TCGA-DJ-A3VL-01 | Thyroid | thyroid carcinoma | Male | <65 | I/II | Unknown | Unknown | PD | ||
WDR17 | insertion | Nonsense_Mutation | novel | c.3176_3177insTTAATTTA | p.Tyr1060Ter | p.Y1060* | Q8IZU2 | protein_coding | TCGA-E8-A436-01 | Thyroid | thyroid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |