![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: ZNF750 |
Gene summary for ZNF750 |
![]() |
Gene information | Species | Human | Gene symbol | ZNF750 | Gene ID | 79755 |
Gene name | zinc finger protein 750 | |
Gene Alias | ZFP750 | |
Cytomap | 17q25.3 | |
Gene Type | protein-coding | GO ID | GO:0000122 | UniProtAcc | Q32MQ0 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
79755 | ZNF750 | LZE4T | Human | Esophagus | ESCC | 1.89e-07 | 2.96e-01 | 0.0811 |
79755 | ZNF750 | LZE7T | Human | Esophagus | ESCC | 2.24e-02 | 1.56e-01 | 0.0667 |
79755 | ZNF750 | LZE20T | Human | Esophagus | ESCC | 1.09e-06 | 3.31e-01 | 0.0662 |
79755 | ZNF750 | LZE22T | Human | Esophagus | ESCC | 1.41e-03 | 6.12e-01 | 0.068 |
79755 | ZNF750 | LZE24T | Human | Esophagus | ESCC | 2.77e-10 | 6.64e-01 | 0.0596 |
79755 | ZNF750 | LZE21T | Human | Esophagus | ESCC | 3.98e-08 | 1.07e+00 | 0.0655 |
79755 | ZNF750 | P1T-E | Human | Esophagus | ESCC | 2.11e-09 | 5.31e-01 | 0.0875 |
79755 | ZNF750 | P2T-E | Human | Esophagus | ESCC | 2.05e-07 | 2.77e-01 | 0.1177 |
79755 | ZNF750 | P4T-E | Human | Esophagus | ESCC | 2.09e-08 | 3.06e-01 | 0.1323 |
79755 | ZNF750 | P5T-E | Human | Esophagus | ESCC | 1.80e-15 | 4.04e-01 | 0.1327 |
79755 | ZNF750 | P8T-E | Human | Esophagus | ESCC | 2.37e-08 | 2.23e-01 | 0.0889 |
79755 | ZNF750 | P9T-E | Human | Esophagus | ESCC | 8.33e-16 | 5.72e-01 | 0.1131 |
79755 | ZNF750 | P12T-E | Human | Esophagus | ESCC | 2.03e-29 | 1.14e+00 | 0.1122 |
79755 | ZNF750 | P15T-E | Human | Esophagus | ESCC | 6.59e-21 | 9.67e-01 | 0.1149 |
79755 | ZNF750 | P20T-E | Human | Esophagus | ESCC | 7.04e-14 | 6.18e-01 | 0.1124 |
79755 | ZNF750 | P23T-E | Human | Esophagus | ESCC | 1.29e-31 | 1.25e+00 | 0.108 |
79755 | ZNF750 | P24T-E | Human | Esophagus | ESCC | 1.30e-23 | 1.08e+00 | 0.1287 |
79755 | ZNF750 | P26T-E | Human | Esophagus | ESCC | 2.22e-16 | 5.69e-01 | 0.1276 |
79755 | ZNF750 | P27T-E | Human | Esophagus | ESCC | 1.57e-18 | 6.37e-01 | 0.1055 |
79755 | ZNF750 | P28T-E | Human | Esophagus | ESCC | 2.04e-71 | 1.90e+00 | 0.1149 |
Page: 1 2 3 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:000854410 | Esophagus | ESCC | epidermis development | 193/8552 | 324/18723 | 2.87e-07 | 4.19e-06 | 193 |
GO:00018378 | Esophagus | ESCC | epithelial to mesenchymal transition | 95/8552 | 157/18723 | 1.25e-04 | 8.56e-04 | 95 |
GO:00487628 | Esophagus | ESCC | mesenchymal cell differentiation | 133/8552 | 236/18723 | 5.94e-04 | 3.22e-03 | 133 |
GO:00107174 | Esophagus | ESCC | regulation of epithelial to mesenchymal transition | 61/8552 | 99/18723 | 1.01e-03 | 5.09e-03 | 61 |
GO:00604856 | Esophagus | ESCC | mesenchyme development | 156/8552 | 291/18723 | 3.76e-03 | 1.53e-02 | 156 |
GO:00085449 | Oral cavity | OSCC | epidermis development | 171/7305 | 324/18723 | 2.89e-07 | 4.43e-06 | 171 |
GO:00018377 | Oral cavity | OSCC | epithelial to mesenchymal transition | 82/7305 | 157/18723 | 5.09e-04 | 2.98e-03 | 82 |
GO:00107173 | Oral cavity | OSCC | regulation of epithelial to mesenchymal transition | 54/7305 | 99/18723 | 1.21e-03 | 6.10e-03 | 54 |
GO:00487627 | Oral cavity | OSCC | mesenchymal cell differentiation | 109/7305 | 236/18723 | 1.43e-02 | 4.69e-02 | 109 |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ZNF750 | insertion | Frame_Shift_Ins | novel | c.505_506insA | p.Arg169LysfsTer53 | p.R169Kfs*53 | Q32MQ0 | protein_coding | TCGA-DR-A0ZM-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Unspecific | Cisplatin | SD | ||
ZNF750 | deletion | Frame_Shift_Del | novel | c.460delN | p.Glu154LysfsTer212 | p.E154Kfs*212 | Q32MQ0 | protein_coding | TCGA-EA-A44S-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | carboplatin | SD | ||
ZNF750 | insertion | Frame_Shift_Ins | novel | c.753_754insG | p.Leu252AlafsTer16 | p.L252Afs*16 | Q32MQ0 | protein_coding | TCGA-FU-A3TQ-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Unknown | Unknown | SD | ||
ZNF750 | insertion | Frame_Shift_Ins | novel | c.768_769insCCCCATCTAC | p.Ser257ProfsTer14 | p.S257Pfs*14 | Q32MQ0 | protein_coding | TCGA-JW-A5VL-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD | ||
ZNF750 | insertion | Frame_Shift_Ins | novel | c.778dupC | p.Leu260ProfsTer8 | p.L260Pfs*8 | Q32MQ0 | protein_coding | TCGA-LP-A4AV-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD | ||
ZNF750 | insertion | Frame_Shift_Ins | novel | c.983_1002dupTTTCCTCCTATGGTCTCAGA | p.Leu335PhefsTer38 | p.L335Ffs*38 | Q32MQ0 | protein_coding | TCGA-LP-A5U3-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD | ||
ZNF750 | deletion | Frame_Shift_Del | novel | c.613_616delNNNN | p.Tyr205ProfsTer160 | p.Y205Pfs*160 | Q32MQ0 | protein_coding | TCGA-ZJ-AAXJ-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD | ||
ZNF750 | SNV | Missense_Mutation | rs760490074 | c.436N>A | p.Ala146Thr | p.A146T | Q32MQ0 | protein_coding | tolerated(0.83) | benign(0.003) | TCGA-A6-2686-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ZNF750 | SNV | Missense_Mutation | rs752878414 | c.428N>T | p.Pro143Leu | p.P143L | Q32MQ0 | protein_coding | deleterious(0.02) | benign(0.095) | TCGA-A6-3808-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
ZNF750 | SNV | Missense_Mutation | c.1867N>A | p.Ala623Thr | p.A623T | Q32MQ0 | protein_coding | tolerated(0.68) | benign(0.001) | TCGA-AA-A00N-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | PD |
Page: 1 2 3 4 5 6 7 8 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |