![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: VAMP8 |
Gene summary for VAMP8 |
![]() |
Gene information | Species | Human | Gene symbol | VAMP8 | Gene ID | 8673 |
Gene name | vesicle associated membrane protein 8 | |
Gene Alias | EDB | |
Cytomap | 2p11.2 | |
Gene Type | protein-coding | GO ID | GO:0001775 | UniProtAcc | Q9BV40 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
8673 | VAMP8 | CA_HPV_1 | Human | Cervix | CC | 2.02e-09 | 1.13e-01 | 0.0264 |
8673 | VAMP8 | CA_HPV_3 | Human | Cervix | CC | 1.90e-04 | 4.12e-02 | 0.0414 |
8673 | VAMP8 | CCI_1 | Human | Cervix | CC | 1.49e-11 | -9.00e-01 | 0.528 |
8673 | VAMP8 | CCI_3 | Human | Cervix | CC | 8.00e-16 | -9.31e-01 | 0.516 |
8673 | VAMP8 | CCII_1 | Human | Cervix | CC | 3.12e-24 | -9.71e-01 | 0.3249 |
8673 | VAMP8 | sample1 | Human | Cervix | CC | 4.83e-04 | -5.50e-01 | 0.0959 |
8673 | VAMP8 | sample3 | Human | Cervix | CC | 1.02e-05 | 1.36e-01 | 0.1387 |
8673 | VAMP8 | T1 | Human | Cervix | CC | 1.44e-14 | -6.21e-01 | 0.0918 |
8673 | VAMP8 | T3 | Human | Cervix | CC | 1.89e-02 | 1.42e-01 | 0.1389 |
8673 | VAMP8 | HTA11_3410_2000001011 | Human | Colorectum | AD | 3.13e-09 | 2.62e-01 | 0.0155 |
8673 | VAMP8 | HTA11_2487_2000001011 | Human | Colorectum | SER | 2.87e-37 | 1.57e+00 | -0.1808 |
8673 | VAMP8 | HTA11_2951_2000001011 | Human | Colorectum | AD | 3.40e-03 | 4.09e-01 | 0.0216 |
8673 | VAMP8 | HTA11_1938_2000001011 | Human | Colorectum | AD | 3.85e-21 | 9.68e-01 | -0.0811 |
8673 | VAMP8 | HTA11_78_2000001011 | Human | Colorectum | AD | 9.21e-05 | 2.84e-01 | -0.1088 |
8673 | VAMP8 | HTA11_347_2000001011 | Human | Colorectum | AD | 5.43e-36 | 9.15e-01 | -0.1954 |
8673 | VAMP8 | HTA11_411_2000001011 | Human | Colorectum | SER | 4.64e-20 | 2.26e+00 | -0.2602 |
8673 | VAMP8 | HTA11_2112_2000001011 | Human | Colorectum | SER | 2.76e-16 | 1.68e+00 | -0.2196 |
8673 | VAMP8 | HTA11_3361_2000001011 | Human | Colorectum | AD | 1.32e-16 | 7.48e-01 | -0.1207 |
8673 | VAMP8 | HTA11_83_2000001011 | Human | Colorectum | SER | 4.59e-20 | 1.04e+00 | -0.1526 |
8673 | VAMP8 | HTA11_696_2000001011 | Human | Colorectum | AD | 1.24e-43 | 1.16e+00 | -0.1464 |
Page: 1 2 3 4 5 6 7 8 9 10 11 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:001603210 | Cervix | CC | viral process | 109/2311 | 415/18723 | 5.40e-15 | 6.46e-12 | 109 |
GO:001905810 | Cervix | CC | viral life cycle | 87/2311 | 317/18723 | 2.20e-13 | 1.20e-10 | 87 |
GO:007265910 | Cervix | CC | protein localization to plasma membrane | 73/2311 | 284/18723 | 4.95e-10 | 6.73e-08 | 73 |
GO:005212610 | Cervix | CC | movement in host environment | 52/2311 | 175/18723 | 7.03e-10 | 8.76e-08 | 52 |
GO:004440910 | Cervix | CC | entry into host | 47/2311 | 151/18723 | 8.45e-10 | 1.03e-07 | 47 |
GO:005170110 | Cervix | CC | biological process involved in interaction with host | 57/2311 | 203/18723 | 1.18e-09 | 1.41e-07 | 57 |
GO:00321035 | Cervix | CC | positive regulation of response to external stimulus | 95/2311 | 427/18723 | 5.44e-09 | 5.03e-07 | 95 |
GO:004671810 | Cervix | CC | viral entry into host cell | 44/2311 | 144/18723 | 5.47e-09 | 5.03e-07 | 44 |
GO:004440310 | Cervix | CC | biological process involved in symbiotic interaction | 71/2311 | 290/18723 | 7.94e-09 | 6.98e-07 | 71 |
GO:19907788 | Cervix | CC | protein localization to cell periphery | 78/2311 | 333/18723 | 1.22e-08 | 9.73e-07 | 78 |
GO:005087810 | Cervix | CC | regulation of body fluid levels | 78/2311 | 379/18723 | 3.20e-06 | 8.77e-05 | 78 |
GO:00313494 | Cervix | CC | positive regulation of defense response | 60/2311 | 278/18723 | 9.38e-06 | 2.11e-04 | 60 |
GO:00096158 | Cervix | CC | response to virus | 73/2311 | 367/18723 | 2.22e-05 | 3.95e-04 | 73 |
GO:00516567 | Cervix | CC | establishment of organelle localization | 76/2311 | 390/18723 | 3.17e-05 | 5.21e-04 | 76 |
GO:00507273 | Cervix | CC | regulation of inflammatory response | 75/2311 | 386/18723 | 3.95e-05 | 6.18e-04 | 75 |
GO:002241110 | Cervix | CC | cellular component disassembly | 83/2311 | 443/18723 | 6.04e-05 | 8.68e-04 | 83 |
GO:00507294 | Cervix | CC | positive regulation of inflammatory response | 34/2311 | 142/18723 | 9.51e-05 | 1.25e-03 | 34 |
GO:19030768 | Cervix | CC | regulation of protein localization to plasma membrane | 27/2311 | 104/18723 | 1.15e-04 | 1.44e-03 | 27 |
GO:00162367 | Cervix | CC | macroautophagy | 58/2311 | 291/18723 | 1.40e-04 | 1.70e-03 | 58 |
GO:19043758 | Cervix | CC | regulation of protein localization to cell periphery | 30/2311 | 125/18723 | 2.28e-04 | 2.56e-03 | 30 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa046115 | Cervix | CC | Platelet activation | 28/1267 | 124/8465 | 1.50e-02 | 4.45e-02 | 2.63e-02 | 28 |
hsa0461113 | Cervix | CC | Platelet activation | 28/1267 | 124/8465 | 1.50e-02 | 4.45e-02 | 2.63e-02 | 28 |
hsa04140 | Colorectum | AD | Autophagy - animal | 49/2092 | 141/8465 | 4.58e-03 | 2.20e-02 | 1.40e-02 | 49 |
hsa041401 | Colorectum | AD | Autophagy - animal | 49/2092 | 141/8465 | 4.58e-03 | 2.20e-02 | 1.40e-02 | 49 |
hsa041402 | Colorectum | SER | Autophagy - animal | 39/1580 | 141/8465 | 5.43e-03 | 3.28e-02 | 2.38e-02 | 39 |
hsa041403 | Colorectum | SER | Autophagy - animal | 39/1580 | 141/8465 | 5.43e-03 | 3.28e-02 | 2.38e-02 | 39 |
hsa041404 | Colorectum | MSS | Autophagy - animal | 45/1875 | 141/8465 | 4.42e-03 | 1.90e-02 | 1.16e-02 | 45 |
hsa041405 | Colorectum | MSS | Autophagy - animal | 45/1875 | 141/8465 | 4.42e-03 | 1.90e-02 | 1.16e-02 | 45 |
hsa0414010 | Esophagus | ESCC | Autophagy - animal | 101/4205 | 141/8465 | 7.60e-08 | 6.21e-07 | 3.18e-07 | 101 |
hsa041305 | Esophagus | ESCC | SNARE interactions in vesicular transport | 28/4205 | 33/8465 | 2.75e-05 | 1.32e-04 | 6.75e-05 | 28 |
hsa0414015 | Esophagus | ESCC | Autophagy - animal | 101/4205 | 141/8465 | 7.60e-08 | 6.21e-07 | 3.18e-07 | 101 |
hsa0413012 | Esophagus | ESCC | SNARE interactions in vesicular transport | 28/4205 | 33/8465 | 2.75e-05 | 1.32e-04 | 6.75e-05 | 28 |
hsa041406 | Liver | Cirrhotic | Autophagy - animal | 65/2530 | 141/8465 | 3.10e-05 | 2.47e-04 | 1.52e-04 | 65 |
hsa04130 | Liver | Cirrhotic | SNARE interactions in vesicular transport | 18/2530 | 33/8465 | 2.64e-03 | 1.10e-02 | 6.76e-03 | 18 |
hsa0414011 | Liver | Cirrhotic | Autophagy - animal | 65/2530 | 141/8465 | 3.10e-05 | 2.47e-04 | 1.52e-04 | 65 |
hsa041301 | Liver | Cirrhotic | SNARE interactions in vesicular transport | 18/2530 | 33/8465 | 2.64e-03 | 1.10e-02 | 6.76e-03 | 18 |
hsa0414021 | Liver | HCC | Autophagy - animal | 99/4020 | 141/8465 | 3.08e-08 | 4.70e-07 | 2.61e-07 | 99 |
hsa046112 | Liver | HCC | Platelet activation | 71/4020 | 124/8465 | 1.77e-02 | 4.15e-02 | 2.31e-02 | 71 |
hsa0414031 | Liver | HCC | Autophagy - animal | 99/4020 | 141/8465 | 3.08e-08 | 4.70e-07 | 2.61e-07 | 99 |
hsa0461111 | Liver | HCC | Platelet activation | 71/4020 | 124/8465 | 1.77e-02 | 4.15e-02 | 2.31e-02 | 71 |
Page: 1 2 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
VAMP8 | deletion | Frame_Shift_Del | novel | c.34_53delCGTGTGCGGAACCTGCAAAG | p.Arg12Ter | p.R12* | Q9BV40 | protein_coding | TCGA-DD-A39Y-01 | Liver | liver hepatocellular carcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
Page: 1 2 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |