![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: RNF11 |
Gene summary for RNF11 |
![]() |
Gene information | Species | Human | Gene symbol | RNF11 | Gene ID | 26994 |
Gene name | ring finger protein 11 | |
Gene Alias | CGI-123 | |
Cytomap | 1p32.3 | |
Gene Type | protein-coding | GO ID | GO:0006464 | UniProtAcc | Q9Y3C5 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
26994 | RNF11 | LZE4T | Human | Esophagus | ESCC | 1.38e-07 | 5.51e-02 | 0.0811 |
26994 | RNF11 | LZE5T | Human | Esophagus | ESCC | 1.41e-02 | 1.85e-01 | 0.0514 |
26994 | RNF11 | LZE7T | Human | Esophagus | ESCC | 5.24e-05 | -9.32e-02 | 0.0667 |
26994 | RNF11 | LZE8T | Human | Esophagus | ESCC | 1.27e-03 | -2.21e-01 | 0.067 |
26994 | RNF11 | LZE22D1 | Human | Esophagus | HGIN | 1.52e-04 | -5.07e-02 | 0.0595 |
26994 | RNF11 | LZE24T | Human | Esophagus | ESCC | 8.02e-18 | 8.69e-01 | 0.0596 |
26994 | RNF11 | P2T-E | Human | Esophagus | ESCC | 5.76e-47 | 8.60e-01 | 0.1177 |
26994 | RNF11 | P4T-E | Human | Esophagus | ESCC | 4.10e-11 | 3.69e-01 | 0.1323 |
26994 | RNF11 | P5T-E | Human | Esophagus | ESCC | 5.55e-17 | 3.19e-01 | 0.1327 |
26994 | RNF11 | P8T-E | Human | Esophagus | ESCC | 5.82e-22 | 4.94e-01 | 0.0889 |
26994 | RNF11 | P9T-E | Human | Esophagus | ESCC | 5.69e-11 | 2.40e-01 | 0.1131 |
26994 | RNF11 | P10T-E | Human | Esophagus | ESCC | 7.88e-35 | 7.65e-01 | 0.116 |
26994 | RNF11 | P11T-E | Human | Esophagus | ESCC | 3.26e-07 | 5.97e-01 | 0.1426 |
26994 | RNF11 | P12T-E | Human | Esophagus | ESCC | 7.01e-20 | 5.93e-01 | 0.1122 |
26994 | RNF11 | P15T-E | Human | Esophagus | ESCC | 1.07e-21 | 6.80e-01 | 0.1149 |
26994 | RNF11 | P16T-E | Human | Esophagus | ESCC | 3.34e-18 | 2.01e-01 | 0.1153 |
26994 | RNF11 | P17T-E | Human | Esophagus | ESCC | 7.30e-07 | 6.32e-01 | 0.1278 |
26994 | RNF11 | P19T-E | Human | Esophagus | ESCC | 7.13e-08 | 1.04e+00 | 0.1662 |
26994 | RNF11 | P20T-E | Human | Esophagus | ESCC | 1.60e-20 | 7.24e-01 | 0.1124 |
26994 | RNF11 | P21T-E | Human | Esophagus | ESCC | 1.87e-36 | 8.32e-01 | 0.1617 |
Page: 1 2 3 4 5 6 7 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:190332010 | Cervix | CC | regulation of protein modification by small protein conjugation or removal | 66/2311 | 242/18723 | 2.31e-10 | 3.46e-08 | 66 |
GO:003139610 | Cervix | CC | regulation of protein ubiquitination | 59/2311 | 210/18723 | 5.90e-10 | 7.51e-08 | 59 |
GO:00071738 | Cervix | CC | epidermal growth factor receptor signaling pathway | 36/2311 | 108/18723 | 1.04e-08 | 8.44e-07 | 36 |
GO:00381278 | Cervix | CC | ERBB signaling pathway | 37/2311 | 121/18723 | 8.57e-08 | 4.88e-06 | 37 |
GO:00002097 | Cervix | CC | protein polyubiquitination | 58/2311 | 236/18723 | 1.57e-07 | 7.41e-06 | 58 |
GO:00709366 | Cervix | CC | protein K48-linked ubiquitination | 22/2311 | 65/18723 | 5.56e-06 | 1.38e-04 | 22 |
GO:00420586 | Cervix | CC | regulation of epidermal growth factor receptor signaling pathway | 21/2311 | 73/18723 | 1.36e-04 | 1.67e-03 | 21 |
GO:19011846 | Cervix | CC | regulation of ERBB signaling pathway | 22/2311 | 79/18723 | 1.61e-04 | 1.93e-03 | 22 |
GO:00071786 | Cervix | CC | transmembrane receptor protein serine/threonine kinase signaling pathway | 67/2311 | 355/18723 | 2.39e-04 | 2.67e-03 | 67 |
GO:00715595 | Cervix | CC | response to transforming growth factor beta | 50/2311 | 256/18723 | 6.31e-04 | 5.91e-03 | 50 |
GO:00715605 | Cervix | CC | cellular response to transforming growth factor beta stimulus | 49/2311 | 250/18723 | 6.55e-04 | 6.05e-03 | 49 |
GO:00071795 | Cervix | CC | transforming growth factor beta receptor signaling pathway | 38/2311 | 198/18723 | 3.62e-03 | 2.31e-02 | 38 |
GO:19011857 | Cervix | CC | negative regulation of ERBB signaling pathway | 10/2311 | 32/18723 | 3.96e-03 | 2.48e-02 | 10 |
GO:00420597 | Cervix | CC | negative regulation of epidermal growth factor receptor signaling pathway | 9/2311 | 28/18723 | 5.02e-03 | 2.98e-02 | 9 |
GO:00313983 | Cervix | CC | positive regulation of protein ubiquitination | 25/2311 | 119/18723 | 5.09e-03 | 3.01e-02 | 25 |
GO:19033224 | Cervix | CC | positive regulation of protein modification by small protein conjugation or removal | 28/2311 | 138/18723 | 5.26e-03 | 3.08e-02 | 28 |
GO:00518656 | Cervix | CC | protein autoubiquitination | 17/2311 | 73/18723 | 6.71e-03 | 3.70e-02 | 17 |
GO:00705343 | Cervix | CC | protein K63-linked ubiquitination | 14/2311 | 56/18723 | 6.93e-03 | 3.74e-02 | 14 |
GO:1903320 | Colorectum | AD | regulation of protein modification by small protein conjugation or removal | 86/3918 | 242/18723 | 9.43e-08 | 4.65e-06 | 86 |
GO:0031396 | Colorectum | AD | regulation of protein ubiquitination | 72/3918 | 210/18723 | 4.50e-06 | 1.21e-04 | 72 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
RNF11 | SNV | Missense_Mutation | c.407N>A | p.Cys136Tyr | p.C136Y | Q9Y3C5 | protein_coding | deleterious(0) | probably_damaging(1) | TCGA-BR-4201-01 | Stomach | stomach adenocarcinoma | Female | >=65 | I/II | Chemotherapy | cisplatin | SD | |
RNF11 | SNV | Missense_Mutation | novel | c.404N>T | p.Thr135Met | p.T135M | Q9Y3C5 | protein_coding | deleterious(0.01) | probably_damaging(0.996) | TCGA-VQ-A8P2-01 | Stomach | stomach adenocarcinoma | Male | >=65 | III/IV | Unspecific | Complete Response | |
RNF11 | deletion | In_Frame_Del | novel | c.225_248delTCTTATACAACATCTGCCTAAAGG | p.Leu76_Gly83del | p.L76_G83del | Q9Y3C5 | protein_coding | TCGA-3M-AB46-01 | Stomach | stomach adenocarcinoma | Male | >=65 | I/II | Chemotherapy | fluorouracil | CR |
Page: 1 2 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |