![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: RBP4 |
Gene summary for RBP4 |
![]() |
Gene information | Species | Human | Gene symbol | RBP4 | Gene ID | 5950 |
Gene name | retinol binding protein 4 | |
Gene Alias | MCOPCB10 | |
Cytomap | 10q23.33 | |
Gene Type | protein-coding | GO ID | GO:0000003 | UniProtAcc | P02753 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
5950 | RBP4 | P31T-E | Human | Esophagus | ESCC | 2.85e-73 | 2.47e+00 | 0.1251 |
5950 | RBP4 | P49T-E | Human | Esophagus | ESCC | 7.48e-03 | 1.29e+00 | 0.1768 |
5950 | RBP4 | P75T-E | Human | Esophagus | ESCC | 1.66e-02 | 1.26e-01 | 0.1125 |
5950 | RBP4 | P76T-E | Human | Esophagus | ESCC | 2.06e-08 | 3.48e-01 | 0.1207 |
5950 | RBP4 | P79T-E | Human | Esophagus | ESCC | 3.97e-04 | 1.65e-01 | 0.1154 |
5950 | RBP4 | P82T-E | Human | Esophagus | ESCC | 9.44e-05 | 6.17e-01 | 0.1072 |
5950 | RBP4 | P130T-E | Human | Esophagus | ESCC | 2.02e-06 | 5.20e-01 | 0.1676 |
5950 | RBP4 | NAFLD1 | Human | Liver | NAFLD | 2.72e-04 | -3.48e-01 | -0.04 |
5950 | RBP4 | S42 | Human | Liver | HCC | 1.67e-15 | 9.54e-01 | -0.0103 |
5950 | RBP4 | S43 | Human | Liver | Cirrhotic | 8.62e-26 | 4.30e-01 | -0.0187 |
5950 | RBP4 | S44 | Human | Liver | HCC | 2.39e-07 | 7.29e-01 | -0.0083 |
5950 | RBP4 | HCC1_Meng | Human | Liver | HCC | 4.16e-15 | 4.06e-01 | 0.0246 |
5950 | RBP4 | HCC2_Meng | Human | Liver | HCC | 1.55e-69 | -1.26e+00 | 0.0107 |
5950 | RBP4 | cirrhotic1 | Human | Liver | Cirrhotic | 5.91e-03 | 2.30e-01 | 0.0202 |
5950 | RBP4 | cirrhotic2 | Human | Liver | Cirrhotic | 9.50e-03 | 2.28e-01 | 0.0201 |
5950 | RBP4 | cirrhotic3 | Human | Liver | Cirrhotic | 3.29e-04 | -5.07e-01 | 0.0215 |
5950 | RBP4 | p6 | Human | Liver | Cyst | 1.60e-12 | -1.26e+00 | -0.0218 |
5950 | RBP4 | HCC1 | Human | Liver | HCC | 6.00e-34 | 7.74e+00 | 0.5336 |
5950 | RBP4 | HCC2 | Human | Liver | HCC | 2.28e-31 | 6.67e+00 | 0.5341 |
5950 | RBP4 | HCC5 | Human | Liver | HCC | 5.90e-03 | 4.18e+00 | 0.4932 |
Page: 1 2 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:1904951111 | Esophagus | ESCC | positive regulation of establishment of protein localization | 216/8552 | 319/18723 | 1.01e-15 | 6.86e-14 | 216 |
GO:0051222111 | Esophagus | ESCC | positive regulation of protein transport | 204/8552 | 303/18723 | 1.56e-14 | 8.38e-13 | 204 |
GO:00059969 | Esophagus | ESCC | monosaccharide metabolic process | 159/8552 | 257/18723 | 1.11e-07 | 1.81e-06 | 159 |
GO:0061458110 | Esophagus | ESCC | reproductive system development | 247/8552 | 427/18723 | 2.24e-07 | 3.42e-06 | 247 |
GO:00193189 | Esophagus | ESCC | hexose metabolic process | 147/8552 | 237/18723 | 2.63e-07 | 3.94e-06 | 147 |
GO:004860818 | Esophagus | ESCC | reproductive structure development | 245/8552 | 424/18723 | 2.82e-07 | 4.14e-06 | 245 |
GO:00060668 | Esophagus | ESCC | alcohol metabolic process | 202/8552 | 353/18723 | 7.32e-06 | 7.26e-05 | 202 |
GO:00303239 | Esophagus | ESCC | respiratory tube development | 112/8552 | 181/18723 | 7.82e-06 | 7.69e-05 | 112 |
GO:00459267 | Esophagus | ESCC | negative regulation of growth | 148/8552 | 249/18723 | 7.88e-06 | 7.73e-05 | 148 |
GO:00605417 | Esophagus | ESCC | respiratory system development | 123/8552 | 203/18723 | 1.26e-05 | 1.15e-04 | 123 |
GO:00303249 | Esophagus | ESCC | lung development | 109/8552 | 177/18723 | 1.40e-05 | 1.27e-04 | 109 |
GO:00060069 | Esophagus | ESCC | glucose metabolic process | 119/8552 | 196/18723 | 1.51e-05 | 1.36e-04 | 119 |
GO:00160514 | Esophagus | ESCC | carbohydrate biosynthetic process | 117/8552 | 202/18723 | 2.96e-04 | 1.79e-03 | 117 |
GO:00485687 | Esophagus | ESCC | embryonic organ development | 228/8552 | 427/18723 | 7.28e-04 | 3.79e-03 | 228 |
GO:00463643 | Esophagus | ESCC | monosaccharide biosynthetic process | 52/8552 | 82/18723 | 9.03e-04 | 4.61e-03 | 52 |
GO:00193193 | Esophagus | ESCC | hexose biosynthetic process | 49/8552 | 78/18723 | 1.69e-03 | 7.81e-03 | 49 |
GO:0097305111 | Esophagus | ESCC | response to alcohol | 138/8552 | 253/18723 | 2.70e-03 | 1.14e-02 | 138 |
GO:000930617 | Esophagus | ESCC | protein secretion | 190/8552 | 359/18723 | 3.22e-03 | 1.34e-02 | 190 |
GO:003559217 | Esophagus | ESCC | establishment of protein localization to extracellular region | 190/8552 | 360/18723 | 3.77e-03 | 1.53e-02 | 190 |
GO:006053716 | Esophagus | ESCC | muscle tissue development | 211/8552 | 403/18723 | 3.84e-03 | 1.56e-02 | 211 |
Page: 1 2 3 4 5 6 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
RBP4 | SNV | Missense_Mutation | novel | c.241N>A | p.Leu81Ile | p.L81I | P02753 | protein_coding | tolerated(0.34) | benign(0.033) | TCGA-EO-A3AV-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Chemotherapy | carboplatin | CR |
RBP4 | SNV | Missense_Mutation | novel | c.112N>G | p.Phe38Val | p.F38V | P02753 | protein_coding | deleterious(0) | benign(0.311) | TCGA-EY-A215-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
RBP4 | SNV | Missense_Mutation | rs367834906 | c.122C>T | p.Thr41Ile | p.T41I | P02753 | protein_coding | tolerated(0.16) | benign(0.036) | TCGA-DD-A4NK-01 | Liver | liver hepatocellular carcinoma | Female | >=65 | III/IV | Unknown | Unknown | PD |
RBP4 | insertion | In_Frame_Ins | novel | c.8_28dupGGGTGTGGGCGCTCTTGCTGT | p.Trp3_Leu9dup | p.W3_L9dup | P02753 | protein_coding | TCGA-66-2787-01 | Lung | lung squamous cell carcinoma | Male | <65 | I/II | Unknown | Unknown | SD | ||
RBP4 | SNV | Missense_Mutation | novel | c.13T>C | p.Trp5Arg | p.W5R | P02753 | protein_coding | tolerated(0.35) | benign(0.011) | TCGA-CV-7248-01 | Oral cavity | head & neck squamous cell carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
RBP4 | SNV | Missense_Mutation | rs747468011 | c.416N>A | p.Arg139His | p.R139H | P02753 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-BR-8487-01 | Stomach | stomach adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
RBP4 | SNV | Missense_Mutation | c.268N>A | p.Asp90Asn | p.D90N | P02753 | protein_coding | tolerated(0.14) | benign(0.027) | TCGA-D7-8570-01 | Stomach | stomach adenocarcinoma | Male | <65 | III/IV | Chemotherapy | plfe | SD | |
RBP4 | SNV | Missense_Mutation | novel | c.551N>T | p.Arg184Met | p.R184M | P02753 | protein_coding | deleterious(0) | probably_damaging(0.944) | TCGA-VQ-A91K-01 | Stomach | stomach adenocarcinoma | Male | >=65 | III/IV | Chemotherapy | fluorouracil | CR |
Page: 1 2 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
5950 | RBP4 | DRUGGABLE GENOME | US8853215, 3 | |||
5950 | RBP4 | DRUGGABLE GENOME | US8586571, 36 | |||
5950 | RBP4 | DRUGGABLE GENOME | FENRETINIDE | FENRETINIDE | 16034410 | |
5950 | RBP4 | DRUGGABLE GENOME | US9434727, 120 | |||
5950 | RBP4 | DRUGGABLE GENOME | FENRETINIDE | FENRETINIDE | 21591606 | |
5950 | RBP4 | DRUGGABLE GENOME | A1-10436 | |||
5950 | RBP4 | DRUGGABLE GENOME | US9434727, 63 | |||
5950 | RBP4 | DRUGGABLE GENOME | US9434727, 40 | |||
5950 | RBP4 | DRUGGABLE GENOME | US8586571, 12 | |||
5950 | RBP4 | DRUGGABLE GENOME | A1-10438 |
Page: 1 2 |