Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: CYBA

Gene summary for CYBA

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

CYBA

Gene ID

1535

Gene namecytochrome b-245 alpha chain
Gene AliasCGD4
Cytomap16q24.2
Gene Typeprotein-coding
GO ID

GO:0001101

UniProtAcc

B4DT46


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
1535CYBAGSM4909281HumanBreastIDC5.10e-031.87e-010.21
1535CYBAGSM4909285HumanBreastIDC1.04e-074.01e-020.21
1535CYBAGSM4909286HumanBreastIDC3.91e-09-2.31e-010.1081
1535CYBAGSM4909290HumanBreastIDC3.89e-18-6.32e-010.2096
1535CYBAGSM4909292HumanBreastIDC7.11e-04-7.13e-010.1236
1535CYBAGSM4909293HumanBreastIDC4.64e-05-5.09e-020.1581
1535CYBAGSM4909294HumanBreastIDC1.45e-21-6.28e-010.2022
1535CYBAGSM4909296HumanBreastIDC1.26e-081.94e-010.1524
1535CYBAGSM4909297HumanBreastIDC2.34e-29-6.63e-010.1517
1535CYBAGSM4909298HumanBreastIDC1.15e-06-2.97e-010.1551
1535CYBAGSM4909302HumanBreastIDC1.02e-14-4.90e-010.1545
1535CYBAGSM4909304HumanBreastIDC1.56e-074.09e-010.1636
1535CYBAGSM4909305HumanBreastIDC4.62e-05-3.25e-010.0436
1535CYBAGSM4909306HumanBreastIDC2.45e-16-5.51e-010.1564
1535CYBAGSM4909311HumanBreastIDC3.91e-24-5.82e-010.1534
1535CYBAGSM4909312HumanBreastIDC5.42e-15-4.99e-010.1552
1535CYBAGSM4909315HumanBreastIDC5.00e-02-2.91e-010.21
1535CYBAGSM4909317HumanBreastIDC7.29e-085.15e-010.1355
1535CYBAGSM4909319HumanBreastIDC7.70e-37-6.94e-010.1563
1535CYBAGSM4909320HumanBreastIDC2.31e-13-7.04e-010.1575
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
BreastThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.IDC: Invasive ductal carcinoma
DCIS: Ductal carcinoma in situ
Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers
CervixThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.CC: Cervix cancer
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions
N_HPV: HPV-infected normal cervix
Colorectum (GSE201348)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.FAP: Familial adenomatous polyposis
CRC: Colorectal cancer
Colorectum (HTA11)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AD: Adenomas
SER: Sessile serrated lesions
MSI-H: Microsatellite-high colorectal cancer
MSS: Microsatellite stable colorectal cancer
EndometriumThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AEH: Atypical endometrial hyperplasia
EEC: Endometrioid Cancer
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
GCThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.CAG: Chronic atrophic gastritis
CAG with IM: Chronic atrophic gastritis with intestinal metaplasia
CSG: Chronic superficial gastritis
GC: Gastric cancer
SIM: Severe intestinal metaplasia
WIM: Wild intestinal metaplasia
LiverThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.HCC: Hepatocellular carcinoma
NAFLD: Non-alcoholic fatty liver disease
LungThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AAH: Atypical adenomatous hyperplasia
AIS: Adenocarcinoma in situ
IAC: Invasive lung adenocarcinoma
MIA: Minimally invasive adenocarcinoma
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
ProstateThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.BPH: Benign Prostatic Hyperplasia
SkinThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AK: Actinic keratosis
cSCC: Cutaneous squamous cell carcinoma
SCCIS:squamous cell carcinoma in situ
ThyroidThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ATC: Anaplastic thyroid cancer
HT: Hashimoto's thyroiditis
PTC: Papillary thyroid cancer
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:00060918BreastPrecancergeneration of precursor metabolites and energy94/1080490/187231.54e-251.64e-2294
GO:00229008BreastPrecancerelectron transport chain42/1080175/187231.37e-154.59e-1342
GO:00362939BreastPrecancerresponse to decreased oxygen levels53/1080322/187234.09e-126.84e-1053
GO:00016669BreastPrecancerresponse to hypoxia51/1080307/187237.33e-121.11e-0951
GO:00704829BreastPrecancerresponse to oxygen levels55/1080347/187237.47e-121.11e-0955
GO:00485459BreastPrecancerresponse to steroid hormone53/1080339/187233.07e-113.66e-0953
GO:00319608BreastPrecancerresponse to corticosteroid30/1080167/187232.50e-081.65e-0630
GO:00018196BreastPrecancerpositive regulation of cytokine production52/1080467/187234.18e-061.29e-0452
GO:00512358BreastPrecancermaintenance of location40/1080327/187235.85e-061.71e-0440
GO:00516519BreastPrecancermaintenance of location in cell30/1080214/187235.91e-061.71e-0430
GO:00103323BreastPrecancerresponse to gamma radiation13/108056/187231.35e-053.38e-0413
GO:00321034BreastPrecancerpositive regulation of response to external stimulus46/1080427/187233.41e-057.40e-0446
GO:00342849BreastPrecancerresponse to monosaccharide29/1080225/187234.19e-059.00e-0429
GO:00725938BreastPrecancerreactive oxygen species metabolic process30/1080239/187235.13e-051.07e-0330
GO:00506736BreastPrecancerepithelial cell proliferation46/1080437/187236.02e-051.23e-0346
GO:00097439BreastPrecancerresponse to carbohydrate31/1080253/187236.15e-051.25e-0331
GO:00313493BreastPrecancerpositive regulation of defense response33/1080278/187236.79e-051.36e-0333
GO:00093148BreastPrecancerresponse to radiation47/1080456/187238.39e-051.62e-0347
GO:00425938BreastPrecancerglucose homeostasis31/1080258/187238.89e-051.69e-0331
GO:00712147BreastPrecancercellular response to abiotic stimulus37/1080331/187239.12e-051.73e-0337
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
hsa0502016BreastPrecancerPrion disease95/684273/84651.39e-371.46e-351.12e-3595
hsa0520818BreastPrecancerChemical carcinogenesis - reactive oxygen species68/684223/84653.61e-231.14e-218.73e-2268
hsa0541518BreastPrecancerDiabetic cardiomyopathy63/684203/84655.63e-221.48e-201.14e-2063
hsa0541818BreastPrecancerFluid shear stress and atherosclerosis28/684139/84654.74e-066.00e-054.59e-0528
hsa0541718BreastPrecancerLipid and atherosclerosis37/684215/84657.64e-069.29e-057.12e-0537
hsa0414518BreastPrecancerPhagosome27/684152/84657.37e-056.85e-045.25e-0427
hsa0467018BreastPrecancerLeukocyte transendothelial migration20/684114/84657.26e-045.33e-034.09e-0320
hsa0502017BreastPrecancerPrion disease95/684273/84651.39e-371.46e-351.12e-3595
hsa0520819BreastPrecancerChemical carcinogenesis - reactive oxygen species68/684223/84653.61e-231.14e-218.73e-2268
hsa0541519BreastPrecancerDiabetic cardiomyopathy63/684203/84655.63e-221.48e-201.14e-2063
hsa0541819BreastPrecancerFluid shear stress and atherosclerosis28/684139/84654.74e-066.00e-054.59e-0528
hsa0541719BreastPrecancerLipid and atherosclerosis37/684215/84657.64e-069.29e-057.12e-0537
hsa0414519BreastPrecancerPhagosome27/684152/84657.37e-056.85e-045.25e-0427
hsa0467019BreastPrecancerLeukocyte transendothelial migration20/684114/84657.26e-045.33e-034.09e-0320
hsa0502023BreastIDCPrion disease102/867273/84653.70e-344.01e-323.00e-32102
hsa0520824BreastIDCChemical carcinogenesis - reactive oxygen species71/867223/84652.55e-197.53e-185.63e-1871
hsa0541523BreastIDCDiabetic cardiomyopathy67/867203/84653.17e-198.59e-186.43e-1867
hsa0541824BreastIDCFluid shear stress and atherosclerosis34/867139/84659.41e-071.61e-051.20e-0534
hsa0414522BreastIDCPhagosome34/867152/84658.00e-069.99e-057.48e-0534
hsa0541724BreastIDCLipid and atherosclerosis35/867215/84653.67e-032.29e-021.71e-0235
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
CYBAdeletionFrame_Shift_Delnovelc.246_273delCTTTACCAGGAATTACTATGTTCGGGCCp.Phe83SerfsTer99p.F83Sfs*99P13498protein_codingTCGA-CG-4460-01Stomachstomach adenocarcinomaFemale>=65III/IVChemotherapycapecitabinePD
Page: 1 2 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
1535CYBATRANSPORTERsimvastatinSIMVASTATIN15936011
1535CYBATRANSPORTERidarubicinIDARUBICIN19448608,28485375,16330681,25823784
1535CYBATRANSPORTERdoxorubicinDOXORUBICIN19448608,28485375,21048526,16330681,25823784
Page: 1