![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: ARL5A |
Gene summary for ARL5A |
![]() |
Gene information | Species | Human | Gene symbol | ARL5A | Gene ID | 26225 |
Gene name | ADP ribosylation factor like GTPase 5A | |
Gene Alias | ARFLP5 | |
Cytomap | 2q23.3 | |
Gene Type | protein-coding | GO ID | GO:0006810 | UniProtAcc | Q9Y689 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
26225 | ARL5A | LZE2D | Human | Esophagus | HGIN | 2.21e-03 | 2.87e-01 | 0.0642 |
26225 | ARL5A | LZE2T | Human | Esophagus | ESCC | 3.70e-10 | 1.04e+00 | 0.082 |
26225 | ARL5A | LZE4T | Human | Esophagus | ESCC | 1.57e-33 | 9.81e-01 | 0.0811 |
26225 | ARL5A | LZE5T | Human | Esophagus | ESCC | 2.52e-06 | 3.23e-01 | 0.0514 |
26225 | ARL5A | LZE7T | Human | Esophagus | ESCC | 2.36e-03 | 2.59e-01 | 0.0667 |
26225 | ARL5A | LZE8T | Human | Esophagus | ESCC | 7.78e-05 | 8.66e-02 | 0.067 |
26225 | ARL5A | LZE20T | Human | Esophagus | ESCC | 6.18e-10 | 3.54e-01 | 0.0662 |
26225 | ARL5A | LZE22D1 | Human | Esophagus | HGIN | 1.51e-04 | 3.66e-01 | 0.0595 |
26225 | ARL5A | LZE22T | Human | Esophagus | ESCC | 1.12e-15 | 9.92e-01 | 0.068 |
26225 | ARL5A | LZE24T | Human | Esophagus | ESCC | 6.72e-36 | 7.85e-01 | 0.0596 |
26225 | ARL5A | LZE21T | Human | Esophagus | ESCC | 2.37e-10 | 3.98e-01 | 0.0655 |
26225 | ARL5A | LZE6T | Human | Esophagus | ESCC | 5.52e-03 | 9.63e-02 | 0.0845 |
26225 | ARL5A | P1T-E | Human | Esophagus | ESCC | 9.48e-11 | 6.05e-01 | 0.0875 |
26225 | ARL5A | P2T-E | Human | Esophagus | ESCC | 5.89e-44 | 8.73e-01 | 0.1177 |
26225 | ARL5A | P4T-E | Human | Esophagus | ESCC | 2.06e-74 | 1.61e+00 | 0.1323 |
26225 | ARL5A | P5T-E | Human | Esophagus | ESCC | 6.45e-40 | 8.23e-01 | 0.1327 |
26225 | ARL5A | P8T-E | Human | Esophagus | ESCC | 1.64e-45 | 9.43e-01 | 0.0889 |
26225 | ARL5A | P9T-E | Human | Esophagus | ESCC | 1.55e-39 | 7.96e-01 | 0.1131 |
26225 | ARL5A | P10T-E | Human | Esophagus | ESCC | 8.20e-60 | 1.14e+00 | 0.116 |
26225 | ARL5A | P11T-E | Human | Esophagus | ESCC | 2.25e-37 | 1.15e+00 | 0.1426 |
Page: 1 2 3 4 5 6 7 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00340676 | Esophagus | ESCC | protein localization to Golgi apparatus | 23/8552 | 29/18723 | 2.25e-04 | 1.40e-03 | 23 |
GO:003406711 | Liver | Cirrhotic | protein localization to Golgi apparatus | 17/4634 | 29/18723 | 1.05e-04 | 1.08e-03 | 17 |
GO:003406721 | Liver | HCC | protein localization to Golgi apparatus | 23/7958 | 29/18723 | 5.86e-05 | 5.38e-04 | 23 |
GO:00340675 | Oral cavity | OSCC | protein localization to Golgi apparatus | 21/7305 | 29/18723 | 2.73e-04 | 1.73e-03 | 21 |
GO:003406713 | Oral cavity | LP | protein localization to Golgi apparatus | 14/4623 | 29/18723 | 4.98e-03 | 3.10e-02 | 14 |
GO:00340674 | Prostate | BPH | protein localization to Golgi apparatus | 14/3107 | 29/18723 | 7.48e-05 | 7.24e-04 | 14 |
GO:003406712 | Prostate | Tumor | protein localization to Golgi apparatus | 15/3246 | 29/18723 | 2.48e-05 | 3.10e-04 | 15 |
GO:00340677 | Thyroid | PTC | protein localization to Golgi apparatus | 20/5968 | 29/18723 | 4.54e-05 | 4.09e-04 | 20 |
GO:003406714 | Thyroid | ATC | protein localization to Golgi apparatus | 21/6293 | 29/18723 | 2.21e-05 | 1.96e-04 | 21 |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ARL5A | SNV | Missense_Mutation | novel | c.65N>C | p.Val22Ala | p.V22A | Q9Y689 | protein_coding | deleterious(0) | probably_damaging(0.943) | TCGA-EY-A215-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ARL5A | SNV | Missense_Mutation | novel | c.416N>T | p.Ser139Phe | p.S139F | Q9Y689 | protein_coding | deleterious(0) | probably_damaging(0.968) | TCGA-FI-A2D4-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Chemotherapy | carboplatinum | PD |
ARL5A | insertion | Nonsense_Mutation | novel | c.346_401dupAGAAAAGCTGGATTGCTGATTTTTGCTAATAAACAAGATGTTAAAGAATGCATGAC | p.Val135GlufsTer6 | p.V135Efs*6 | Q9Y689 | protein_coding | TCGA-PD-A5DF-01 | Liver | liver hepatocellular carcinoma | Female | <65 | III/IV | Unknown | Unknown | PD | ||
ARL5A | SNV | Missense_Mutation | c.356G>C | p.Gly119Ala | p.G119A | Q9Y689 | protein_coding | tolerated(0.88) | benign(0.007) | TCGA-44-6779-01 | Lung | lung adenocarcinoma | Female | <65 | I/II | Chemotherapy | taxol | PD | |
ARL5A | SNV | Missense_Mutation | novel | c.536N>A | p.Arg179Lys | p.R179K | Q9Y689 | protein_coding | tolerated(0.22) | benign(0.038) | TCGA-60-2703-01 | Lung | lung squamous cell carcinoma | Male | >=65 | I/II | Unknown | Unknown | PD |
ARL5A | SNV | Missense_Mutation | c.211N>A | p.Glu71Lys | p.E71K | Q9Y689 | protein_coding | deleterious(0.01) | probably_damaging(0.932) | TCGA-60-2713-01 | Lung | lung squamous cell carcinoma | Male | <65 | I/II | Chemotherapy | gemzar | SD | |
ARL5A | SNV | Missense_Mutation | novel | c.536N>C | p.Arg179Thr | p.R179T | Q9Y689 | protein_coding | deleterious(0) | possibly_damaging(0.776) | TCGA-CQ-A4C9-01 | Oral cavity | head & neck squamous cell carcinoma | Male | <65 | III/IV | Unknown | Unknown | PD |
ARL5A | SNV | Missense_Mutation | novel | c.200N>C | p.Ile67Thr | p.I67T | Q9Y689 | protein_coding | deleterious(0.03) | possibly_damaging(0.754) | TCGA-CQ-A4CD-01 | Oral cavity | head & neck squamous cell carcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
ARL5A | SNV | Missense_Mutation | novel | c.182N>A | p.Arg61His | p.R61H | Q9Y689 | protein_coding | tolerated(1) | benign(0) | TCGA-CG-4460-01 | Stomach | stomach adenocarcinoma | Female | >=65 | III/IV | Chemotherapy | capecitabine | PD |
ARL5A | SNV | Missense_Mutation | c.406N>A | p.Ala136Thr | p.A136T | Q9Y689 | protein_coding | tolerated(0.15) | benign(0.031) | TCGA-F1-A448-01 | Stomach | stomach adenocarcinoma | Male | >=65 | III/IV | Chemotherapy | capecitabine | CR |
Page: 1 2 3 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |