Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: MECOM

Gene summary for MECOM

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

MECOM

Gene ID

2122

Gene nameMDS1 and EVI1 complex locus
Gene AliasAML1-EVI-1
Cytomap3q26.2
Gene Typeprotein-coding
GO ID

GO:0000165

UniProtAcc

Q03112


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
2122MECOMCA_HPV_1HumanCervixCC1.93e-06-1.60e-010.0264
2122MECOMCA_HPV_2HumanCervixCC2.80e-033.81e-010.0391
2122MECOMN_HPV_1HumanCervixN_HPV3.98e-02-1.45e-010.0079
2122MECOMCCI_1HumanCervixCC7.01e-282.25e+000.528
2122MECOMCCI_2HumanCervixCC2.96e-037.08e-010.5249
2122MECOMCCI_3HumanCervixCC4.23e-452.79e+000.516
2122MECOMCCII_1HumanCervixCC6.13e-261.10e+000.3249
2122MECOMH2HumanCervixHSIL_HPV5.01e-105.29e-010.0632
2122MECOMHTA11_3410_2000001011HumanColorectumAD2.81e-13-4.52e-010.0155
2122MECOMHTA11_2951_2000001011HumanColorectumAD2.82e-03-5.54e-010.0216
2122MECOMHTA11_1938_2000001011HumanColorectumAD3.82e-167.84e-01-0.0811
2122MECOMHTA11_78_2000001011HumanColorectumAD4.46e-065.12e-01-0.1088
2122MECOMHTA11_347_2000001011HumanColorectumAD6.52e-126.83e-01-0.1954
2122MECOMHTA11_3361_2000001011HumanColorectumAD1.39e-12-7.28e-01-0.1207
2122MECOMHTA11_83_2000001011HumanColorectumSER1.21e-074.44e-01-0.1526
2122MECOMHTA11_696_2000001011HumanColorectumAD2.83e-05-2.70e-01-0.1464
2122MECOMHTA11_1391_2000001011HumanColorectumAD2.47e-068.59e-01-0.059
2122MECOMHTA11_5212_2000001011HumanColorectumAD4.66e-16-8.60e-01-0.2061
2122MECOMHTA11_5216_2000001011HumanColorectumSER2.26e-02-4.92e-01-0.1462
2122MECOMHTA11_866_3004761011HumanColorectumAD1.34e-07-5.23e-010.096
Page: 1 2 3 4 5 6 7 8 9 10 11 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
CervixThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.CC: Cervix cancer
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions
N_HPV: HPV-infected normal cervix
Colorectum (GSE201348)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.FAP: Familial adenomatous polyposis
CRC: Colorectal cancer
Colorectum (HTA11)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AD: Adenomas
SER: Sessile serrated lesions
MSI-H: Microsatellite-high colorectal cancer
MSS: Microsatellite stable colorectal cancer
EndometriumThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AEH: Atypical endometrial hyperplasia
EEC: Endometrioid Cancer
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
GCThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.CAG: Chronic atrophic gastritis
CAG with IM: Chronic atrophic gastritis with intestinal metaplasia
CSG: Chronic superficial gastritis
GC: Gastric cancer
SIM: Severe intestinal metaplasia
WIM: Wild intestinal metaplasia
LiverThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.HCC: Hepatocellular carcinoma
NAFLD: Non-alcoholic fatty liver disease
LungThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AAH: Atypical adenomatous hyperplasia
AIS: Adenocarcinoma in situ
IAC: Invasive lung adenocarcinoma
MIA: Minimally invasive adenocarcinoma
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
ProstateThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.BPH: Benign Prostatic Hyperplasia
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:00310988CervixCCstress-activated protein kinase signaling cascade58/2311247/187238.02e-072.89e-0558
GO:00514038CervixCCstress-activated MAPK cascade55/2311239/187232.96e-068.31e-0555
GO:00703027CervixCCregulation of stress-activated protein kinase signaling cascade46/2311195/187239.35e-062.11e-0446
GO:00328727CervixCCregulation of stress-activated MAPK cascade44/2311192/187233.09e-055.10e-0444
GO:00063257CervixCCchromatin organization78/2311409/187235.40e-058.02e-0478
GO:00165705CervixCChistone modification84/2311463/187231.70e-042.01e-0384
GO:00349685CervixCChistone lysine methylation27/2311115/187236.61e-046.09e-0327
GO:00072545CervixCCJNK cascade35/2311167/187231.10e-039.09e-0335
GO:00434099CervixCCnegative regulation of MAPK cascade37/2311180/187231.17e-039.50e-0337
GO:00165715CervixCChistone methylation30/2311141/187231.88e-031.39e-0230
GO:00180224CervixCCpeptidyl-lysine methylation28/2311131/187232.43e-031.71e-0228
GO:00064795CervixCCprotein methylation36/2311181/187232.46e-031.71e-0236
GO:00082135CervixCCprotein alkylation36/2311181/187232.46e-031.71e-0236
GO:00463285CervixCCregulation of JNK cascade28/2311133/187233.06e-032.01e-0228
GO:00328737CervixCCnegative regulation of stress-activated MAPK cascade13/231151/187237.67e-034.07e-0213
GO:00703037CervixCCnegative regulation of stress-activated protein kinase signaling cascade13/231151/187237.67e-034.07e-0213
GO:00182054CervixCCpeptidyl-lysine modification62/2311376/187231.04e-024.97e-0262
GO:004340913CervixHSIL_HPVnegative regulation of MAPK cascade16/737180/187232.05e-032.13e-0216
GO:003287314CervixHSIL_HPVnegative regulation of stress-activated MAPK cascade7/73751/187233.65e-033.25e-027
GO:007030314CervixHSIL_HPVnegative regulation of stress-activated protein kinase signaling cascade7/73751/187233.65e-033.25e-027
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
hsa0522014CervixCCChronic myeloid leukemia21/126776/84653.08e-031.19e-027.03e-0321
hsa040109CervixCCMAPK signaling pathway62/1267302/84654.89e-031.67e-029.86e-0362
hsa0522015CervixCCChronic myeloid leukemia21/126776/84653.08e-031.19e-027.03e-0321
hsa0401012CervixCCMAPK signaling pathway62/1267302/84654.89e-031.67e-029.86e-0362
hsa00310ColorectumADLysine degradation27/209263/84651.17e-037.75e-034.94e-0327
hsa05220ColorectumADChronic myeloid leukemia31/209276/84651.41e-038.46e-035.39e-0331
hsa003101ColorectumADLysine degradation27/209263/84651.17e-037.75e-034.94e-0327
hsa052201ColorectumADChronic myeloid leukemia31/209276/84651.41e-038.46e-035.39e-0331
hsa052202ColorectumMSSChronic myeloid leukemia29/187576/84651.10e-036.27e-033.84e-0329
hsa003102ColorectumMSSLysine degradation24/187563/84652.94e-031.39e-028.50e-0324
hsa052203ColorectumMSSChronic myeloid leukemia29/187576/84651.10e-036.27e-033.84e-0329
hsa003103ColorectumMSSLysine degradation24/187563/84652.94e-031.39e-028.50e-0324
hsa003104ColorectumFAPLysine degradation23/140463/84651.04e-049.46e-045.76e-0423
hsa052204ColorectumFAPChronic myeloid leukemia23/140476/84652.14e-031.05e-026.39e-0323
hsa04010ColorectumFAPMAPK signaling pathway68/1404302/84654.00e-031.67e-021.02e-0268
hsa003105ColorectumFAPLysine degradation23/140463/84651.04e-049.46e-045.76e-0423
hsa052205ColorectumFAPChronic myeloid leukemia23/140476/84652.14e-031.05e-026.39e-0323
hsa040101ColorectumFAPMAPK signaling pathway68/1404302/84654.00e-031.67e-021.02e-0268
hsa040102ColorectumCRCMAPK signaling pathway56/1091302/84652.76e-031.77e-021.20e-0256
hsa052206ColorectumCRCChronic myeloid leukemia18/109176/84656.86e-033.37e-022.28e-0218
Page: 1 2 3 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
MECOMBASBreastHealthyLTBP4,SEMA3G,ARL15, etc.3.05e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
MECOMPVABreastADJNOTCH4,GFOD1,SPRY1, etc.2.54e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
MECOMMSC.ADIPOBreastDCISNOTCH4,GFOD1,SPRY1, etc.1.84e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
MECOMPVABreastHealthyNOTCH4,GFOD1,SPRY1, etc.2.39e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
MECOMMSC.ADIPOBreastHealthyNOTCH4,GFOD1,SPRY1, etc.2.08e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
MECOMMVABreastHealthyNOTCH4,GFOD1,SPRY1, etc.1.63e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
MECOMPVABreastPrecancerNOTCH4,GFOD1,SPRY1, etc.2.79e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
MECOMPLAEndometriumADJESR1,NPAS3,RHEX, etc.7.00e-02The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
MECOMPLAEndometriumEECESR1,NPAS3,RHEX, etc.4.71e-02The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
MECOMPVAEndometriumADJARL15,EXOC6,KCTD12, etc.4.79e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 2 3 4 5 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
MECOMSNVMissense_Mutationrs149928659c.1315G>Ap.Glu439Lysp.E439KQ03112protein_codingtolerated(0.05)benign(0.182)TCGA-KU-A66T-01Oral cavityhead & neck squamous cell carcinomaFemale<65I/IIUnknownUnknownPD
MECOMSNVMissense_Mutationnovelc.2537N>Ap.Arg846Hisp.R846HQ03112protein_codingdeleterious(0)probably_damaging(0.96)TCGA-QK-A6V9-01Oral cavityhead & neck squamous cell carcinomaMale<65I/IIUnknownUnknownSD
MECOMdeletionFrame_Shift_Delnovelc.1134_1168delCAGGCCTCCTTTGATACCTGCTAGTTCTCCTGTTAp.His378GlnfsTer7p.H378Qfs*7Q03112protein_codingTCGA-CR-7373-01Oral cavityhead & neck squamous cell carcinomaMale>=65I/IIChemotherapycisplatinSD
MECOMSNVMissense_Mutationrs540158912c.2663C>Tp.Ser888Leup.S888LQ03112protein_codingdeleterious(0)probably_damaging(0.996)TCGA-EJ-7125-01Prostateprostate adenocarcinomaMale<657UnknownUnknownSD
MECOMSNVMissense_Mutationc.2375N>Ap.Arg792Glnp.R792QQ03112protein_codingdeleterious(0.03)benign(0.027)TCGA-HC-7742-01Prostateprostate adenocarcinomaMale<657Hormone TherapyeligardPR
MECOMSNVMissense_Mutationc.2375N>Ap.Arg792Glnp.R792QQ03112protein_codingdeleterious(0.03)benign(0.027)TCGA-HC-A631-01Prostateprostate adenocarcinomaMale>=659UnknownUnknownSD
MECOMSNVMissense_Mutationnovelc.3023N>Ap.Ser1008Tyrp.S1008YQ03112protein_codingdeleterious(0.02)probably_damaging(0.964)TCGA-KC-A4BL-01Prostateprostate adenocarcinomaMale>=657UnknownUnknownPD
MECOMSNVMissense_Mutationnovelc.3228G>Ap.Met1076Ilep.M1076IQ03112protein_codingdeleterious(0)probably_damaging(0.961)TCGA-TP-A8TV-01Prostateprostate adenocarcinomaMale<657UnknownUnknownSD
MECOMSNVMissense_Mutationnovelc.2342N>Tp.Ala781Valp.A781VQ03112protein_codingdeleterious(0.04)benign(0.006)TCGA-XK-AAIW-01Prostateprostate adenocarcinomaMale>=659UnknownUnknownPD
MECOMdeletionFrame_Shift_Delnovelc.2825delNp.Lys942ArgfsTer4p.K942Rfs*4Q03112protein_codingTCGA-CH-5740-01Prostateprostate adenocarcinomaMale<657UnknownUnknownSD
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1