|
Gene: MECOM |
Gene summary for MECOM |
Gene summary. |
Gene information | Species | Human | Gene symbol | MECOM | Gene ID | 2122 |
Gene name | MDS1 and EVI1 complex locus | |
Gene Alias | AML1-EVI-1 | |
Cytomap | 3q26.2 | |
Gene Type | protein-coding | GO ID | GO:0000165 | UniProtAcc | Q03112 |
Top |
Malignant transformation analysis |
Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
Malignant transformation involving gene list. |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
2122 | MECOM | CA_HPV_1 | Human | Cervix | CC | 1.93e-06 | -1.60e-01 | 0.0264 |
2122 | MECOM | CA_HPV_2 | Human | Cervix | CC | 2.80e-03 | 3.81e-01 | 0.0391 |
2122 | MECOM | N_HPV_1 | Human | Cervix | N_HPV | 3.98e-02 | -1.45e-01 | 0.0079 |
2122 | MECOM | CCI_1 | Human | Cervix | CC | 7.01e-28 | 2.25e+00 | 0.528 |
2122 | MECOM | CCI_2 | Human | Cervix | CC | 2.96e-03 | 7.08e-01 | 0.5249 |
2122 | MECOM | CCI_3 | Human | Cervix | CC | 4.23e-45 | 2.79e+00 | 0.516 |
2122 | MECOM | CCII_1 | Human | Cervix | CC | 6.13e-26 | 1.10e+00 | 0.3249 |
2122 | MECOM | H2 | Human | Cervix | HSIL_HPV | 5.01e-10 | 5.29e-01 | 0.0632 |
2122 | MECOM | HTA11_3410_2000001011 | Human | Colorectum | AD | 2.81e-13 | -4.52e-01 | 0.0155 |
2122 | MECOM | HTA11_2951_2000001011 | Human | Colorectum | AD | 2.82e-03 | -5.54e-01 | 0.0216 |
2122 | MECOM | HTA11_1938_2000001011 | Human | Colorectum | AD | 3.82e-16 | 7.84e-01 | -0.0811 |
2122 | MECOM | HTA11_78_2000001011 | Human | Colorectum | AD | 4.46e-06 | 5.12e-01 | -0.1088 |
2122 | MECOM | HTA11_347_2000001011 | Human | Colorectum | AD | 6.52e-12 | 6.83e-01 | -0.1954 |
2122 | MECOM | HTA11_3361_2000001011 | Human | Colorectum | AD | 1.39e-12 | -7.28e-01 | -0.1207 |
2122 | MECOM | HTA11_83_2000001011 | Human | Colorectum | SER | 1.21e-07 | 4.44e-01 | -0.1526 |
2122 | MECOM | HTA11_696_2000001011 | Human | Colorectum | AD | 2.83e-05 | -2.70e-01 | -0.1464 |
2122 | MECOM | HTA11_1391_2000001011 | Human | Colorectum | AD | 2.47e-06 | 8.59e-01 | -0.059 |
2122 | MECOM | HTA11_5212_2000001011 | Human | Colorectum | AD | 4.66e-16 | -8.60e-01 | -0.2061 |
2122 | MECOM | HTA11_5216_2000001011 | Human | Colorectum | SER | 2.26e-02 | -4.92e-01 | -0.1462 |
2122 | MECOM | HTA11_866_3004761011 | Human | Colorectum | AD | 1.34e-07 | -5.23e-01 | 0.096 |
Page: 1 2 3 4 5 6 7 8 9 10 11 |
Transcriptomic changes along malignancy continuum. |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
Figure of enriched GO biological processes. |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | |
Colorectum | SER | |
Colorectum | MSS | |
Colorectum | MSI-H | |
Colorectum | FAP |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
Enriched GO biological processes. |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00310988 | Cervix | CC | stress-activated protein kinase signaling cascade | 58/2311 | 247/18723 | 8.02e-07 | 2.89e-05 | 58 |
GO:00514038 | Cervix | CC | stress-activated MAPK cascade | 55/2311 | 239/18723 | 2.96e-06 | 8.31e-05 | 55 |
GO:00703027 | Cervix | CC | regulation of stress-activated protein kinase signaling cascade | 46/2311 | 195/18723 | 9.35e-06 | 2.11e-04 | 46 |
GO:00328727 | Cervix | CC | regulation of stress-activated MAPK cascade | 44/2311 | 192/18723 | 3.09e-05 | 5.10e-04 | 44 |
GO:00063257 | Cervix | CC | chromatin organization | 78/2311 | 409/18723 | 5.40e-05 | 8.02e-04 | 78 |
GO:00165705 | Cervix | CC | histone modification | 84/2311 | 463/18723 | 1.70e-04 | 2.01e-03 | 84 |
GO:00349685 | Cervix | CC | histone lysine methylation | 27/2311 | 115/18723 | 6.61e-04 | 6.09e-03 | 27 |
GO:00072545 | Cervix | CC | JNK cascade | 35/2311 | 167/18723 | 1.10e-03 | 9.09e-03 | 35 |
GO:00434099 | Cervix | CC | negative regulation of MAPK cascade | 37/2311 | 180/18723 | 1.17e-03 | 9.50e-03 | 37 |
GO:00165715 | Cervix | CC | histone methylation | 30/2311 | 141/18723 | 1.88e-03 | 1.39e-02 | 30 |
GO:00180224 | Cervix | CC | peptidyl-lysine methylation | 28/2311 | 131/18723 | 2.43e-03 | 1.71e-02 | 28 |
GO:00064795 | Cervix | CC | protein methylation | 36/2311 | 181/18723 | 2.46e-03 | 1.71e-02 | 36 |
GO:00082135 | Cervix | CC | protein alkylation | 36/2311 | 181/18723 | 2.46e-03 | 1.71e-02 | 36 |
GO:00463285 | Cervix | CC | regulation of JNK cascade | 28/2311 | 133/18723 | 3.06e-03 | 2.01e-02 | 28 |
GO:00328737 | Cervix | CC | negative regulation of stress-activated MAPK cascade | 13/2311 | 51/18723 | 7.67e-03 | 4.07e-02 | 13 |
GO:00703037 | Cervix | CC | negative regulation of stress-activated protein kinase signaling cascade | 13/2311 | 51/18723 | 7.67e-03 | 4.07e-02 | 13 |
GO:00182054 | Cervix | CC | peptidyl-lysine modification | 62/2311 | 376/18723 | 1.04e-02 | 4.97e-02 | 62 |
GO:004340913 | Cervix | HSIL_HPV | negative regulation of MAPK cascade | 16/737 | 180/18723 | 2.05e-03 | 2.13e-02 | 16 |
GO:003287314 | Cervix | HSIL_HPV | negative regulation of stress-activated MAPK cascade | 7/737 | 51/18723 | 3.65e-03 | 3.25e-02 | 7 |
GO:007030314 | Cervix | HSIL_HPV | negative regulation of stress-activated protein kinase signaling cascade | 7/737 | 51/18723 | 3.65e-03 | 3.25e-02 | 7 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 |
Enriched KEGG pathways. |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa0522014 | Cervix | CC | Chronic myeloid leukemia | 21/1267 | 76/8465 | 3.08e-03 | 1.19e-02 | 7.03e-03 | 21 |
hsa040109 | Cervix | CC | MAPK signaling pathway | 62/1267 | 302/8465 | 4.89e-03 | 1.67e-02 | 9.86e-03 | 62 |
hsa0522015 | Cervix | CC | Chronic myeloid leukemia | 21/1267 | 76/8465 | 3.08e-03 | 1.19e-02 | 7.03e-03 | 21 |
hsa0401012 | Cervix | CC | MAPK signaling pathway | 62/1267 | 302/8465 | 4.89e-03 | 1.67e-02 | 9.86e-03 | 62 |
hsa00310 | Colorectum | AD | Lysine degradation | 27/2092 | 63/8465 | 1.17e-03 | 7.75e-03 | 4.94e-03 | 27 |
hsa05220 | Colorectum | AD | Chronic myeloid leukemia | 31/2092 | 76/8465 | 1.41e-03 | 8.46e-03 | 5.39e-03 | 31 |
hsa003101 | Colorectum | AD | Lysine degradation | 27/2092 | 63/8465 | 1.17e-03 | 7.75e-03 | 4.94e-03 | 27 |
hsa052201 | Colorectum | AD | Chronic myeloid leukemia | 31/2092 | 76/8465 | 1.41e-03 | 8.46e-03 | 5.39e-03 | 31 |
hsa052202 | Colorectum | MSS | Chronic myeloid leukemia | 29/1875 | 76/8465 | 1.10e-03 | 6.27e-03 | 3.84e-03 | 29 |
hsa003102 | Colorectum | MSS | Lysine degradation | 24/1875 | 63/8465 | 2.94e-03 | 1.39e-02 | 8.50e-03 | 24 |
hsa052203 | Colorectum | MSS | Chronic myeloid leukemia | 29/1875 | 76/8465 | 1.10e-03 | 6.27e-03 | 3.84e-03 | 29 |
hsa003103 | Colorectum | MSS | Lysine degradation | 24/1875 | 63/8465 | 2.94e-03 | 1.39e-02 | 8.50e-03 | 24 |
hsa003104 | Colorectum | FAP | Lysine degradation | 23/1404 | 63/8465 | 1.04e-04 | 9.46e-04 | 5.76e-04 | 23 |
hsa052204 | Colorectum | FAP | Chronic myeloid leukemia | 23/1404 | 76/8465 | 2.14e-03 | 1.05e-02 | 6.39e-03 | 23 |
hsa04010 | Colorectum | FAP | MAPK signaling pathway | 68/1404 | 302/8465 | 4.00e-03 | 1.67e-02 | 1.02e-02 | 68 |
hsa003105 | Colorectum | FAP | Lysine degradation | 23/1404 | 63/8465 | 1.04e-04 | 9.46e-04 | 5.76e-04 | 23 |
hsa052205 | Colorectum | FAP | Chronic myeloid leukemia | 23/1404 | 76/8465 | 2.14e-03 | 1.05e-02 | 6.39e-03 | 23 |
hsa040101 | Colorectum | FAP | MAPK signaling pathway | 68/1404 | 302/8465 | 4.00e-03 | 1.67e-02 | 1.02e-02 | 68 |
hsa040102 | Colorectum | CRC | MAPK signaling pathway | 56/1091 | 302/8465 | 2.76e-03 | 1.77e-02 | 1.20e-02 | 56 |
hsa052206 | Colorectum | CRC | Chronic myeloid leukemia | 18/1091 | 76/8465 | 6.86e-03 | 3.37e-02 | 2.28e-02 | 18 |
Page: 1 2 3 |
Top |
Cell-cell communication analysis |
Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 2 3 4 5 |
Top |
Somatic mutation of malignant transformation related genes |
Annotation of somatic variants for genes involved in malignant transformation |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
MECOM | SNV | Missense_Mutation | rs149928659 | c.1315G>A | p.Glu439Lys | p.E439K | Q03112 | protein_coding | tolerated(0.05) | benign(0.182) | TCGA-KU-A66T-01 | Oral cavity | head & neck squamous cell carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
MECOM | SNV | Missense_Mutation | novel | c.2537N>A | p.Arg846His | p.R846H | Q03112 | protein_coding | deleterious(0) | probably_damaging(0.96) | TCGA-QK-A6V9-01 | Oral cavity | head & neck squamous cell carcinoma | Male | <65 | I/II | Unknown | Unknown | SD |
MECOM | deletion | Frame_Shift_Del | novel | c.1134_1168delCAGGCCTCCTTTGATACCTGCTAGTTCTCCTGTTA | p.His378GlnfsTer7 | p.H378Qfs*7 | Q03112 | protein_coding | TCGA-CR-7373-01 | Oral cavity | head & neck squamous cell carcinoma | Male | >=65 | I/II | Chemotherapy | cisplatin | SD | ||
MECOM | SNV | Missense_Mutation | rs540158912 | c.2663C>T | p.Ser888Leu | p.S888L | Q03112 | protein_coding | deleterious(0) | probably_damaging(0.996) | TCGA-EJ-7125-01 | Prostate | prostate adenocarcinoma | Male | <65 | 7 | Unknown | Unknown | SD |
MECOM | SNV | Missense_Mutation | c.2375N>A | p.Arg792Gln | p.R792Q | Q03112 | protein_coding | deleterious(0.03) | benign(0.027) | TCGA-HC-7742-01 | Prostate | prostate adenocarcinoma | Male | <65 | 7 | Hormone Therapy | eligard | PR | |
MECOM | SNV | Missense_Mutation | c.2375N>A | p.Arg792Gln | p.R792Q | Q03112 | protein_coding | deleterious(0.03) | benign(0.027) | TCGA-HC-A631-01 | Prostate | prostate adenocarcinoma | Male | >=65 | 9 | Unknown | Unknown | SD | |
MECOM | SNV | Missense_Mutation | novel | c.3023N>A | p.Ser1008Tyr | p.S1008Y | Q03112 | protein_coding | deleterious(0.02) | probably_damaging(0.964) | TCGA-KC-A4BL-01 | Prostate | prostate adenocarcinoma | Male | >=65 | 7 | Unknown | Unknown | PD |
MECOM | SNV | Missense_Mutation | novel | c.3228G>A | p.Met1076Ile | p.M1076I | Q03112 | protein_coding | deleterious(0) | probably_damaging(0.961) | TCGA-TP-A8TV-01 | Prostate | prostate adenocarcinoma | Male | <65 | 7 | Unknown | Unknown | SD |
MECOM | SNV | Missense_Mutation | novel | c.2342N>T | p.Ala781Val | p.A781V | Q03112 | protein_coding | deleterious(0.04) | benign(0.006) | TCGA-XK-AAIW-01 | Prostate | prostate adenocarcinoma | Male | >=65 | 9 | Unknown | Unknown | PD |
MECOM | deletion | Frame_Shift_Del | novel | c.2825delN | p.Lys942ArgfsTer4 | p.K942Rfs*4 | Q03112 | protein_coding | TCGA-CH-5740-01 | Prostate | prostate adenocarcinoma | Male | <65 | 7 | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 |
Top |
Related drugs of malignant transformation related genes |
Identification of chemicals and drugs interact with genes involved in malignant transfromation |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |