Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: RREB1

Gene summary for RREB1

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

RREB1

Gene ID

6239

Gene nameras responsive element binding protein 1
Gene AliasFINB
Cytomap6p24.3
Gene Typeprotein-coding
GO ID

GO:0000122

UniProtAcc

A0A024QZU8


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
6239RREB1CA_HPV_2HumanCervixCC2.30e-021.70e-010.0391
6239RREB1CCI_1HumanCervixCC8.14e-121.40e+000.528
6239RREB1CCI_2HumanCervixCC1.56e-121.34e+000.5249
6239RREB1CCI_3HumanCervixCC5.22e-171.49e+000.516
6239RREB1HTA11_3410_2000001011HumanColorectumAD5.91e-30-7.49e-010.0155
6239RREB1HTA11_3361_2000001011HumanColorectumAD2.54e-06-5.37e-01-0.1207
6239RREB1HTA11_546_2000001011HumanColorectumAD5.98e-03-4.03e-01-0.0842
6239RREB1HTA11_866_3004761011HumanColorectumAD1.15e-13-6.51e-010.096
6239RREB1HTA11_8622_2000001021HumanColorectumSER6.89e-04-7.30e-010.0528
6239RREB1HTA11_10711_2000001011HumanColorectumAD8.34e-04-5.48e-010.0338
6239RREB1HTA11_7696_3000711011HumanColorectumAD1.21e-13-5.44e-010.0674
6239RREB1HTA11_99999970781_79442HumanColorectumMSS7.08e-26-6.47e-010.294
6239RREB1HTA11_99999971662_82457HumanColorectumMSS9.49e-06-3.51e-010.3859
6239RREB1HTA11_99999974143_84620HumanColorectumMSS1.25e-28-6.24e-010.3005
6239RREB1A002-C-010HumanColorectumFAP4.16e-02-3.04e-010.242
6239RREB1A001-C-207HumanColorectumFAP2.73e-04-2.95e-010.1278
6239RREB1A015-C-203HumanColorectumFAP4.62e-36-5.48e-01-0.1294
6239RREB1A015-C-204HumanColorectumFAP2.71e-06-4.33e-01-0.0228
6239RREB1A014-C-040HumanColorectumFAP3.47e-07-5.89e-01-0.1184
6239RREB1A002-C-201HumanColorectumFAP3.01e-13-4.48e-010.0324
Page: 1 2 3 4 5 6 7 8 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
CervixThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.CC: Cervix cancer
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions
N_HPV: HPV-infected normal cervix
Colorectum (GSE201348)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.FAP: Familial adenomatous polyposis
CRC: Colorectal cancer
Colorectum (HTA11)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AD: Adenomas
SER: Sessile serrated lesions
MSI-H: Microsatellite-high colorectal cancer
MSS: Microsatellite stable colorectal cancer
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
SkinThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AK: Actinic keratosis
cSCC: Cutaneous squamous cell carcinoma
SCCIS:squamous cell carcinoma in situ
ThyroidThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ATC: Anaplastic thyroid cancer
HT: Hashimoto's thyroiditis
PTC: Papillary thyroid cancer
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:004206010CervixCCwound healing109/2311422/187231.84e-141.57e-11109
GO:001081010CervixCCregulation of cell-substrate adhesion69/2311221/187238.57e-145.69e-1169
GO:00315898CervixCCcell-substrate adhesion96/2311363/187231.48e-138.85e-1196
GO:002260410CervixCCregulation of cell morphogenesis84/2311309/187231.00e-124.29e-1084
GO:009013210CervixCCepithelium migration90/2311360/187232.45e-116.11e-0990
GO:00016679CervixCCameboidal-type cell migration110/2311475/187232.66e-116.36e-09110
GO:001063110CervixCCepithelial cell migration89/2311357/187233.72e-118.54e-0989
GO:009013010CervixCCtissue migration90/2311365/187235.42e-111.05e-0890
GO:004578510CervixCCpositive regulation of cell adhesion101/2311437/187231.96e-103.08e-08101
GO:00506737CervixCCepithelial cell proliferation98/2311437/187232.01e-092.15e-0798
GO:001063210CervixCCregulation of epithelial cell migration72/2311292/187234.52e-094.43e-0772
GO:00072656CervixCCRas protein signal transduction79/2311337/187239.49e-097.77e-0779
GO:00975817CervixCClamellipodium organization31/231190/187234.57e-082.76e-0631
GO:19000249CervixCCregulation of substrate adhesion-dependent cell spreading23/231157/187238.94e-085.04e-0623
GO:00443193CervixCCwound healing, spreading of cells17/231134/187239.86e-085.25e-0617
GO:00905053CervixCCepiboly involved in wound healing17/231134/187239.86e-085.25e-0617
GO:00506787CervixCCregulation of epithelial cell proliferation83/2311381/187231.31e-076.42e-0683
GO:00905043CervixCCepiboly17/231135/187231.70e-077.93e-0617
GO:00106349CervixCCpositive regulation of epithelial cell migration47/2311176/187231.73e-078.01e-0647
GO:00107699CervixCCregulation of cell morphogenesis involved in differentiation31/231196/187232.43e-071.05e-0531
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
RREB1ABSColorectumSERCDYL,GPR39,TCF7L2, etc.2.67e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
RREB1STMEndometriumADJDAB2IP,LOXL2,SRSF8, etc.6.48e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
RREB1GRAOral cavityHealthyEPPK1,TRA2A,EIF5A, etc.9.53e-02The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
RREB1DUCT1PancreasHealthyJADE2,PTCH1,METTL2B, etc.4.19e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
RREB1STMThyroidADJNEAT1,MT-ND3,PHEX, etc.5.55e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
RREB1STMThyroidPTCNEAT1,MT-ND3,PHEX, etc.4.26e-01The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
RREB1SNVMissense_Mutationnovelc.1804A>Gp.Ile602Valp.I602VQ92766protein_codingtolerated(0.22)benign(0.121)TCGA-QK-AA3K-01Oral cavityhead & neck squamous cell carcinomaMale<65I/IIChemotherapycisplatinSD
RREB1deletionFrame_Shift_Delnovelc.438_460delNNNNNNNNNNNNNNNNNNNNNNNp.Glu148SerfsTer11p.E148Sfs*11Q92766protein_codingTCGA-CV-6948-01Oral cavityhead & neck squamous cell carcinomaFemale>=65I/IIUnknownUnknownSD
RREB1SNVMissense_Mutationrs745668051c.1727G>Ap.Arg576Glnp.R576QQ92766protein_codingtolerated(1)benign(0)TCGA-EJ-5526-01Prostateprostate adenocarcinomaMale<658UnknownUnknownPD
RREB1SNVMissense_Mutationc.2279A>Gp.Glu760Glyp.E760GQ92766protein_codingdeleterious(0)possibly_damaging(0.564)TCGA-HC-A6AP-01Prostateprostate adenocarcinomaMale<657UnknownUnknownSD
RREB1SNVMissense_Mutationrs756205550c.971N>Tp.Ala324Valp.A324VQ92766protein_codingdeleterious(0)probably_damaging(0.99)TCGA-XK-AAIW-01Prostateprostate adenocarcinomaMale>=659UnknownUnknownPD
RREB1deletionFrame_Shift_Delnovelc.3084_3106delACTCGTGGGCAGCTCAGCCCTCCp.Leu1029GlufsTer61p.L1029Efs*61Q92766protein_codingTCGA-HC-A76X-01Prostateprostate adenocarcinomaMale<657UnknownUnknownSD
RREB1SNVMissense_Mutationc.556N>Ap.Ala186Thrp.A186TQ92766protein_codingtolerated(0.5)benign(0.23)TCGA-BR-4191-01Stomachstomach adenocarcinomaMale>=65I/IIChemotherapydocetaxelSD
RREB1SNVMissense_Mutationc.1558G>Ap.Ala520Thrp.A520TQ92766protein_codingtolerated(0.26)benign(0.041)TCGA-BR-4361-01Stomachstomach adenocarcinomaFemale>=65III/IVUnknownUnknownSD
RREB1SNVMissense_Mutationrs763437605c.3256G>Ap.Val1086Metp.V1086MQ92766protein_codingdeleterious(0.04)benign(0.022)TCGA-BR-4361-01Stomachstomach adenocarcinomaFemale>=65III/IVUnknownUnknownSD
RREB1SNVMissense_Mutationnovelc.1928N>Cp.Tyr643Serp.Y643SQ92766protein_codingdeleterious(0)probably_damaging(0.988)TCGA-BR-4362-01Stomachstomach adenocarcinomaFemale>=65I/IIUnknownUnknownSD
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1