![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: RREB1 |
Gene summary for RREB1 |
![]() |
Gene information | Species | Human | Gene symbol | RREB1 | Gene ID | 6239 |
Gene name | ras responsive element binding protein 1 | |
Gene Alias | FINB | |
Cytomap | 6p24.3 | |
Gene Type | protein-coding | GO ID | GO:0000122 | UniProtAcc | A0A024QZU8 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
6239 | RREB1 | CA_HPV_2 | Human | Cervix | CC | 2.30e-02 | 1.70e-01 | 0.0391 |
6239 | RREB1 | CCI_1 | Human | Cervix | CC | 8.14e-12 | 1.40e+00 | 0.528 |
6239 | RREB1 | CCI_2 | Human | Cervix | CC | 1.56e-12 | 1.34e+00 | 0.5249 |
6239 | RREB1 | CCI_3 | Human | Cervix | CC | 5.22e-17 | 1.49e+00 | 0.516 |
6239 | RREB1 | HTA11_3410_2000001011 | Human | Colorectum | AD | 5.91e-30 | -7.49e-01 | 0.0155 |
6239 | RREB1 | HTA11_3361_2000001011 | Human | Colorectum | AD | 2.54e-06 | -5.37e-01 | -0.1207 |
6239 | RREB1 | HTA11_546_2000001011 | Human | Colorectum | AD | 5.98e-03 | -4.03e-01 | -0.0842 |
6239 | RREB1 | HTA11_866_3004761011 | Human | Colorectum | AD | 1.15e-13 | -6.51e-01 | 0.096 |
6239 | RREB1 | HTA11_8622_2000001021 | Human | Colorectum | SER | 6.89e-04 | -7.30e-01 | 0.0528 |
6239 | RREB1 | HTA11_10711_2000001011 | Human | Colorectum | AD | 8.34e-04 | -5.48e-01 | 0.0338 |
6239 | RREB1 | HTA11_7696_3000711011 | Human | Colorectum | AD | 1.21e-13 | -5.44e-01 | 0.0674 |
6239 | RREB1 | HTA11_99999970781_79442 | Human | Colorectum | MSS | 7.08e-26 | -6.47e-01 | 0.294 |
6239 | RREB1 | HTA11_99999971662_82457 | Human | Colorectum | MSS | 9.49e-06 | -3.51e-01 | 0.3859 |
6239 | RREB1 | HTA11_99999974143_84620 | Human | Colorectum | MSS | 1.25e-28 | -6.24e-01 | 0.3005 |
6239 | RREB1 | A002-C-010 | Human | Colorectum | FAP | 4.16e-02 | -3.04e-01 | 0.242 |
6239 | RREB1 | A001-C-207 | Human | Colorectum | FAP | 2.73e-04 | -2.95e-01 | 0.1278 |
6239 | RREB1 | A015-C-203 | Human | Colorectum | FAP | 4.62e-36 | -5.48e-01 | -0.1294 |
6239 | RREB1 | A015-C-204 | Human | Colorectum | FAP | 2.71e-06 | -4.33e-01 | -0.0228 |
6239 | RREB1 | A014-C-040 | Human | Colorectum | FAP | 3.47e-07 | -5.89e-01 | -0.1184 |
6239 | RREB1 | A002-C-201 | Human | Colorectum | FAP | 3.01e-13 | -4.48e-01 | 0.0324 |
Page: 1 2 3 4 5 6 7 8 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:004206010 | Cervix | CC | wound healing | 109/2311 | 422/18723 | 1.84e-14 | 1.57e-11 | 109 |
GO:001081010 | Cervix | CC | regulation of cell-substrate adhesion | 69/2311 | 221/18723 | 8.57e-14 | 5.69e-11 | 69 |
GO:00315898 | Cervix | CC | cell-substrate adhesion | 96/2311 | 363/18723 | 1.48e-13 | 8.85e-11 | 96 |
GO:002260410 | Cervix | CC | regulation of cell morphogenesis | 84/2311 | 309/18723 | 1.00e-12 | 4.29e-10 | 84 |
GO:009013210 | Cervix | CC | epithelium migration | 90/2311 | 360/18723 | 2.45e-11 | 6.11e-09 | 90 |
GO:00016679 | Cervix | CC | ameboidal-type cell migration | 110/2311 | 475/18723 | 2.66e-11 | 6.36e-09 | 110 |
GO:001063110 | Cervix | CC | epithelial cell migration | 89/2311 | 357/18723 | 3.72e-11 | 8.54e-09 | 89 |
GO:009013010 | Cervix | CC | tissue migration | 90/2311 | 365/18723 | 5.42e-11 | 1.05e-08 | 90 |
GO:004578510 | Cervix | CC | positive regulation of cell adhesion | 101/2311 | 437/18723 | 1.96e-10 | 3.08e-08 | 101 |
GO:00506737 | Cervix | CC | epithelial cell proliferation | 98/2311 | 437/18723 | 2.01e-09 | 2.15e-07 | 98 |
GO:001063210 | Cervix | CC | regulation of epithelial cell migration | 72/2311 | 292/18723 | 4.52e-09 | 4.43e-07 | 72 |
GO:00072656 | Cervix | CC | Ras protein signal transduction | 79/2311 | 337/18723 | 9.49e-09 | 7.77e-07 | 79 |
GO:00975817 | Cervix | CC | lamellipodium organization | 31/2311 | 90/18723 | 4.57e-08 | 2.76e-06 | 31 |
GO:19000249 | Cervix | CC | regulation of substrate adhesion-dependent cell spreading | 23/2311 | 57/18723 | 8.94e-08 | 5.04e-06 | 23 |
GO:00443193 | Cervix | CC | wound healing, spreading of cells | 17/2311 | 34/18723 | 9.86e-08 | 5.25e-06 | 17 |
GO:00905053 | Cervix | CC | epiboly involved in wound healing | 17/2311 | 34/18723 | 9.86e-08 | 5.25e-06 | 17 |
GO:00506787 | Cervix | CC | regulation of epithelial cell proliferation | 83/2311 | 381/18723 | 1.31e-07 | 6.42e-06 | 83 |
GO:00905043 | Cervix | CC | epiboly | 17/2311 | 35/18723 | 1.70e-07 | 7.93e-06 | 17 |
GO:00106349 | Cervix | CC | positive regulation of epithelial cell migration | 47/2311 | 176/18723 | 1.73e-07 | 8.01e-06 | 47 |
GO:00107699 | Cervix | CC | regulation of cell morphogenesis involved in differentiation | 31/2311 | 96/18723 | 2.43e-07 | 1.05e-05 | 31 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
RREB1 | SNV | Missense_Mutation | novel | c.1804A>G | p.Ile602Val | p.I602V | Q92766 | protein_coding | tolerated(0.22) | benign(0.121) | TCGA-QK-AA3K-01 | Oral cavity | head & neck squamous cell carcinoma | Male | <65 | I/II | Chemotherapy | cisplatin | SD |
RREB1 | deletion | Frame_Shift_Del | novel | c.438_460delNNNNNNNNNNNNNNNNNNNNNNN | p.Glu148SerfsTer11 | p.E148Sfs*11 | Q92766 | protein_coding | TCGA-CV-6948-01 | Oral cavity | head & neck squamous cell carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | ||
RREB1 | SNV | Missense_Mutation | rs745668051 | c.1727G>A | p.Arg576Gln | p.R576Q | Q92766 | protein_coding | tolerated(1) | benign(0) | TCGA-EJ-5526-01 | Prostate | prostate adenocarcinoma | Male | <65 | 8 | Unknown | Unknown | PD |
RREB1 | SNV | Missense_Mutation | c.2279A>G | p.Glu760Gly | p.E760G | Q92766 | protein_coding | deleterious(0) | possibly_damaging(0.564) | TCGA-HC-A6AP-01 | Prostate | prostate adenocarcinoma | Male | <65 | 7 | Unknown | Unknown | SD | |
RREB1 | SNV | Missense_Mutation | rs756205550 | c.971N>T | p.Ala324Val | p.A324V | Q92766 | protein_coding | deleterious(0) | probably_damaging(0.99) | TCGA-XK-AAIW-01 | Prostate | prostate adenocarcinoma | Male | >=65 | 9 | Unknown | Unknown | PD |
RREB1 | deletion | Frame_Shift_Del | novel | c.3084_3106delACTCGTGGGCAGCTCAGCCCTCC | p.Leu1029GlufsTer61 | p.L1029Efs*61 | Q92766 | protein_coding | TCGA-HC-A76X-01 | Prostate | prostate adenocarcinoma | Male | <65 | 7 | Unknown | Unknown | SD | ||
RREB1 | SNV | Missense_Mutation | c.556N>A | p.Ala186Thr | p.A186T | Q92766 | protein_coding | tolerated(0.5) | benign(0.23) | TCGA-BR-4191-01 | Stomach | stomach adenocarcinoma | Male | >=65 | I/II | Chemotherapy | docetaxel | SD | |
RREB1 | SNV | Missense_Mutation | c.1558G>A | p.Ala520Thr | p.A520T | Q92766 | protein_coding | tolerated(0.26) | benign(0.041) | TCGA-BR-4361-01 | Stomach | stomach adenocarcinoma | Female | >=65 | III/IV | Unknown | Unknown | SD | |
RREB1 | SNV | Missense_Mutation | rs763437605 | c.3256G>A | p.Val1086Met | p.V1086M | Q92766 | protein_coding | deleterious(0.04) | benign(0.022) | TCGA-BR-4361-01 | Stomach | stomach adenocarcinoma | Female | >=65 | III/IV | Unknown | Unknown | SD |
RREB1 | SNV | Missense_Mutation | novel | c.1928N>C | p.Tyr643Ser | p.Y643S | Q92766 | protein_coding | deleterious(0) | probably_damaging(0.988) | TCGA-BR-4362-01 | Stomach | stomach adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |