![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: RNF213 |
Gene summary for RNF213 |
![]() |
Gene information | Species | Human | Gene symbol | RNF213 | Gene ID | 57674 |
Gene name | ring finger protein 213 | |
Gene Alias | ALO17 | |
Cytomap | 17q25.3 | |
Gene Type | protein-coding | GO ID | GO:0001525 | UniProtAcc | A0A0A0MTR7 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
57674 | RNF213 | GSM4909287 | Human | Breast | IDC | 4.93e-03 | 2.95e-01 | 0.2057 |
57674 | RNF213 | GSM4909290 | Human | Breast | IDC | 1.66e-04 | 3.56e-01 | 0.2096 |
57674 | RNF213 | GSM4909296 | Human | Breast | IDC | 5.89e-06 | -1.75e-01 | 0.1524 |
57674 | RNF213 | GSM4909297 | Human | Breast | IDC | 9.09e-04 | -1.08e-01 | 0.1517 |
57674 | RNF213 | GSM4909301 | Human | Breast | IDC | 6.83e-07 | 3.71e-01 | 0.1577 |
57674 | RNF213 | GSM4909302 | Human | Breast | IDC | 2.07e-06 | 3.48e-01 | 0.1545 |
57674 | RNF213 | GSM4909307 | Human | Breast | IDC | 1.34e-19 | 5.87e-01 | 0.1569 |
57674 | RNF213 | GSM4909308 | Human | Breast | IDC | 2.78e-06 | 3.48e-01 | 0.158 |
57674 | RNF213 | GSM4909309 | Human | Breast | IDC | 1.92e-02 | 1.36e-01 | 0.0483 |
57674 | RNF213 | GSM4909311 | Human | Breast | IDC | 1.15e-13 | -2.06e-01 | 0.1534 |
57674 | RNF213 | GSM4909312 | Human | Breast | IDC | 3.77e-09 | -1.80e-01 | 0.1552 |
57674 | RNF213 | GSM4909317 | Human | Breast | IDC | 2.06e-21 | 6.33e-01 | 0.1355 |
57674 | RNF213 | GSM4909319 | Human | Breast | IDC | 9.99e-30 | -6.25e-02 | 0.1563 |
57674 | RNF213 | GSM4909320 | Human | Breast | IDC | 1.59e-12 | 5.49e-01 | 0.1575 |
57674 | RNF213 | GSM4909321 | Human | Breast | IDC | 2.09e-20 | 3.84e-01 | 0.1559 |
57674 | RNF213 | M1 | Human | Breast | IDC | 4.87e-17 | 6.28e-01 | 0.1577 |
57674 | RNF213 | M2 | Human | Breast | IDC | 3.77e-02 | 2.20e-01 | 0.21 |
57674 | RNF213 | NCCBC14 | Human | Breast | DCIS | 2.72e-02 | 9.08e-04 | 0.2021 |
57674 | RNF213 | NCCBC5 | Human | Breast | DCIS | 8.11e-11 | 1.31e-01 | 0.2046 |
57674 | RNF213 | P1 | Human | Breast | IDC | 8.10e-30 | 8.05e-01 | 0.1527 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00160557 | Cervix | CC | Wnt signaling pathway | 98/2311 | 444/18723 | 4.82e-09 | 4.65e-07 | 98 |
GO:01987387 | Cervix | CC | cell-cell signaling by wnt | 98/2311 | 446/18723 | 6.16e-09 | 5.58e-07 | 98 |
GO:00301117 | Cervix | CC | regulation of Wnt signaling pathway | 76/2311 | 328/18723 | 3.05e-08 | 2.08e-06 | 76 |
GO:00301784 | Cervix | CC | negative regulation of Wnt signaling pathway | 35/2311 | 170/18723 | 1.52e-03 | 1.17e-02 | 35 |
GO:00518656 | Cervix | CC | protein autoubiquitination | 17/2311 | 73/18723 | 6.71e-03 | 3.70e-02 | 17 |
GO:00301118 | Endometrium | AEH | regulation of Wnt signaling pathway | 71/2100 | 328/18723 | 3.31e-08 | 1.87e-06 | 71 |
GO:00160558 | Endometrium | AEH | Wnt signaling pathway | 85/2100 | 444/18723 | 4.99e-07 | 1.97e-05 | 85 |
GO:01987388 | Endometrium | AEH | cell-cell signaling by wnt | 85/2100 | 446/18723 | 6.07e-07 | 2.29e-05 | 85 |
GO:00301785 | Endometrium | AEH | negative regulation of Wnt signaling pathway | 34/2100 | 170/18723 | 5.63e-04 | 5.62e-03 | 34 |
GO:003011113 | Endometrium | EEC | regulation of Wnt signaling pathway | 74/2168 | 328/18723 | 1.03e-08 | 6.47e-07 | 74 |
GO:001605513 | Endometrium | EEC | Wnt signaling pathway | 90/2168 | 444/18723 | 6.65e-08 | 3.50e-06 | 90 |
GO:019873813 | Endometrium | EEC | cell-cell signaling by wnt | 90/2168 | 446/18723 | 8.25e-08 | 4.23e-06 | 90 |
GO:003017812 | Endometrium | EEC | negative regulation of Wnt signaling pathway | 35/2168 | 170/18723 | 4.84e-04 | 4.96e-03 | 35 |
GO:003011116 | Esophagus | HGIN | regulation of Wnt signaling pathway | 65/2587 | 328/18723 | 1.53e-03 | 1.77e-02 | 65 |
GO:001605516 | Esophagus | HGIN | Wnt signaling pathway | 83/2587 | 444/18723 | 2.27e-03 | 2.33e-02 | 83 |
GO:019873816 | Esophagus | HGIN | cell-cell signaling by wnt | 83/2587 | 446/18723 | 2.58e-03 | 2.55e-02 | 83 |
GO:001605517 | Esophagus | ESCC | Wnt signaling pathway | 268/8552 | 444/18723 | 2.32e-10 | 6.58e-09 | 268 |
GO:019873817 | Esophagus | ESCC | cell-cell signaling by wnt | 269/8552 | 446/18723 | 2.41e-10 | 6.79e-09 | 269 |
GO:003011117 | Esophagus | ESCC | regulation of Wnt signaling pathway | 194/8552 | 328/18723 | 5.39e-07 | 7.14e-06 | 194 |
GO:00518658 | Esophagus | ESCC | protein autoubiquitination | 47/8552 | 73/18723 | 9.72e-04 | 4.93e-03 | 47 |
Page: 1 2 3 4 5 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
RNF213 | insertion | Frame_Shift_Ins | novel | c.6499_6500insT | p.Pro2167LeufsTer64 | p.P2167Lfs*64 | protein_coding | TCGA-AA-3684-01 | Colorectum | colon adenocarcinoma | Female | >=65 | III/IV | Unknown | Unknown | SD | |||
RNF213 | deletion | In_Frame_Del | novel | c.6816_6842delAAGCCCGGGGAAGCACATGGTCACCAT | p.Ser2273_Met2281del | p.S2273_M2281del | protein_coding | TCGA-AM-5820-01 | Colorectum | colon adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |||
RNF213 | insertion | Frame_Shift_Ins | rs768772409 | c.5851_5852insC | p.Gln1953ProfsTer30 | p.Q1953Pfs*30 | protein_coding | TCGA-AZ-6601-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | PD | |||
RNF213 | deletion | Frame_Shift_Del | c.14799delT | p.Leu4934SerfsTer38 | p.L4934Sfs*38 | protein_coding | TCGA-EI-6508-01 | Colorectum | rectum adenocarcinoma | Female | <65 | III/IV | Chemotherapy | oxaliplatin | SD | ||||
RNF213 | SNV | Missense_Mutation | rs760169991 | c.6266N>A | p.Arg2089Gln | p.R2089Q | protein_coding | tolerated(0.12) | probably_damaging(0.996) | TCGA-A5-A0G1-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
RNF213 | SNV | Missense_Mutation | novel | c.9615N>G | p.His3205Gln | p.H3205Q | protein_coding | tolerated(0.91) | benign(0.001) | TCGA-A5-A0G1-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
RNF213 | SNV | Missense_Mutation | novel | c.9745N>C | p.Lys3249Gln | p.K3249Q | protein_coding | tolerated(0.27) | benign(0.013) | TCGA-A5-A0G2-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD | |
RNF213 | SNV | Missense_Mutation | novel | c.9937N>A | p.Ala3313Thr | p.A3313T | protein_coding | tolerated(0.71) | benign(0.013) | TCGA-A5-A0G2-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD | |
RNF213 | SNV | Missense_Mutation | novel | c.12007N>T | p.Asp4003Tyr | p.D4003Y | protein_coding | deleterious(0) | probably_damaging(0.997) | TCGA-A5-A0G2-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD | |
RNF213 | SNV | Missense_Mutation | novel | c.13672N>A | p.Val4558Met | p.V4558M | protein_coding | deleterious(0.01) | possibly_damaging(0.891) | TCGA-A5-A0G2-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |