![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: ALPK3 |
Gene summary for ALPK3 |
![]() |
Gene information | Species | Human | Gene symbol | ALPK3 | Gene ID | 57538 |
Gene name | alpha kinase 3 | |
Gene Alias | CMH27 | |
Cytomap | 15q25.3 | |
Gene Type | protein-coding | GO ID | GO:0006464 | UniProtAcc | Q96L96 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
57538 | ALPK3 | AEH-subject1 | Human | Endometrium | AEH | 1.53e-24 | 5.76e-01 | -0.3059 |
57538 | ALPK3 | AEH-subject2 | Human | Endometrium | AEH | 3.11e-03 | 2.53e-01 | -0.2525 |
57538 | ALPK3 | AEH-subject4 | Human | Endometrium | AEH | 1.08e-15 | 5.71e-01 | -0.2657 |
57538 | ALPK3 | EEC-subject2 | Human | Endometrium | EEC | 4.64e-10 | 3.71e-01 | -0.2607 |
57538 | ALPK3 | GSM6177622_NYU_UCEC3_lib1_lib1 | Human | Endometrium | EEC | 4.33e-02 | 1.63e-01 | -0.1917 |
57538 | ALPK3 | GSM6177623_NYU_UCEC3_Vis | Human | Endometrium | EEC | 3.64e-09 | 4.25e-01 | -0.1269 |
57538 | ALPK3 | HCC1 | Human | Liver | HCC | 1.42e-05 | 2.26e+00 | 0.5336 |
57538 | ALPK3 | Pt13.b | Human | Liver | HCC | 1.41e-02 | 5.34e-02 | 0.0251 |
57538 | ALPK3 | S014 | Human | Liver | HCC | 2.68e-04 | 2.80e-01 | 0.2254 |
57538 | ALPK3 | S015 | Human | Liver | HCC | 6.01e-09 | 4.43e-01 | 0.2375 |
57538 | ALPK3 | S016 | Human | Liver | HCC | 2.13e-08 | 3.23e-01 | 0.2243 |
57538 | ALPK3 | S027 | Human | Liver | HCC | 8.44e-12 | 9.00e-01 | 0.2446 |
57538 | ALPK3 | S028 | Human | Liver | HCC | 1.80e-31 | 9.84e-01 | 0.2503 |
57538 | ALPK3 | S029 | Human | Liver | HCC | 5.87e-22 | 8.27e-01 | 0.2581 |
Page: 1 |
![]() |
Tissue | Expression Dynamics | Abbreviation |
Endometrium | ![]() | AEH: Atypical endometrial hyperplasia |
EEC: Endometrioid Cancer | ||
Liver | ![]() | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00605376 | Endometrium | AEH | muscle tissue development | 83/2100 | 403/18723 | 2.57e-08 | 1.50e-06 | 83 |
GO:00147065 | Endometrium | AEH | striated muscle tissue development | 75/2100 | 384/18723 | 1.06e-06 | 3.62e-05 | 75 |
GO:00426925 | Endometrium | AEH | muscle cell differentiation | 68/2100 | 384/18723 | 8.88e-05 | 1.30e-03 | 68 |
GO:00511465 | Endometrium | AEH | striated muscle cell differentiation | 51/2100 | 283/18723 | 4.20e-04 | 4.46e-03 | 51 |
GO:0048738 | Endometrium | AEH | cardiac muscle tissue development | 43/2100 | 236/18723 | 9.06e-04 | 8.30e-03 | 43 |
GO:006053713 | Endometrium | EEC | muscle tissue development | 82/2168 | 403/18723 | 2.14e-07 | 9.38e-06 | 82 |
GO:001470612 | Endometrium | EEC | striated muscle tissue development | 74/2168 | 384/18723 | 6.64e-06 | 1.57e-04 | 74 |
GO:004269212 | Endometrium | EEC | muscle cell differentiation | 67/2168 | 384/18723 | 3.87e-04 | 4.12e-03 | 67 |
GO:005114613 | Endometrium | EEC | striated muscle cell differentiation | 51/2168 | 283/18723 | 8.71e-04 | 7.97e-03 | 51 |
GO:00487381 | Endometrium | EEC | cardiac muscle tissue development | 42/2168 | 236/18723 | 3.00e-03 | 2.10e-02 | 42 |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ALPK3 | deletion | Frame_Shift_Del | c.2904delN | p.Lys970AsnfsTer12 | p.K970Nfs*12 | Q96L96 | protein_coding | TCGA-B5-A11H-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | III/IV | Hormone Therapy | megace | SD | |||
ALPK3 | deletion | Frame_Shift_Del | novel | c.4536_4566delCAAGGATCAGCGCCCAGTGGGCGAGGTGGGC | p.Lys1513GlyfsTer19 | p.K1513Gfs*19 | Q96L96 | protein_coding | TCGA-BG-A0M8-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
ALPK3 | deletion | Frame_Shift_Del | c.2910delA | p.Lys970AsnfsTer12 | p.K970Nfs*12 | Q96L96 | protein_coding | TCGA-D1-A17A-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |||
ALPK3 | insertion | Frame_Shift_Ins | novel | c.4847dupG | p.Gly1617TrpfsTer43 | p.G1617Wfs*43 | Q96L96 | protein_coding | TCGA-DF-A2KY-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Chemotherapy | carboplatin | SD | ||
ALPK3 | deletion | Frame_Shift_Del | c.2904delN | p.Lys970AsnfsTer12 | p.K970Nfs*12 | Q96L96 | protein_coding | TCGA-DI-A1BU-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Chemotherapy | paclitaxel | SD | |||
ALPK3 | SNV | Missense_Mutation | rs779689802 | c.4637A>G | p.Tyr1546Cys | p.Y1546C | Q96L96 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-4R-AA8I-01 | Liver | liver hepatocellular carcinoma | Male | >=65 | I/II | Unknown | Unknown | PD |
ALPK3 | SNV | Missense_Mutation | c.2781G>T | p.Glu927Asp | p.E927D | Q96L96 | protein_coding | deleterious_low_confidence(0.03) | benign(0.021) | TCGA-05-4250-01 | Lung | lung adenocarcinoma | Female | >=65 | III/IV | Unknown | Unknown | SD | |
ALPK3 | SNV | Missense_Mutation | novel | c.1237N>T | p.Asp413Tyr | p.D413Y | Q96L96 | protein_coding | deleterious(0) | benign(0.292) | TCGA-05-4398-01 | Lung | lung adenocarcinoma | Female | <65 | III/IV | Chemotherapy | carboplatin | CR |
ALPK3 | SNV | Missense_Mutation | c.14N>T | p.Trp5Leu | p.W5L | Q96L96 | protein_coding | tolerated_low_confidence(0.2) | benign(0) | TCGA-05-4410-01 | Lung | lung adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | SD | |
ALPK3 | SNV | Missense_Mutation | c.2501N>T | p.Arg834Met | p.R834M | Q96L96 | protein_coding | deleterious_low_confidence(0.02) | possibly_damaging(0.533) | TCGA-44-2657-01 | Lung | lung adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |