Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: ALPK3

Gene summary for ALPK3

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

ALPK3

Gene ID

57538

Gene namealpha kinase 3
Gene AliasCMH27
Cytomap15q25.3
Gene Typeprotein-coding
GO ID

GO:0006464

UniProtAcc

Q96L96


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
57538ALPK3AEH-subject1HumanEndometriumAEH1.53e-245.76e-01-0.3059
57538ALPK3AEH-subject2HumanEndometriumAEH3.11e-032.53e-01-0.2525
57538ALPK3AEH-subject4HumanEndometriumAEH1.08e-155.71e-01-0.2657
57538ALPK3EEC-subject2HumanEndometriumEEC4.64e-103.71e-01-0.2607
57538ALPK3GSM6177622_NYU_UCEC3_lib1_lib1HumanEndometriumEEC4.33e-021.63e-01-0.1917
57538ALPK3GSM6177623_NYU_UCEC3_VisHumanEndometriumEEC3.64e-094.25e-01-0.1269
57538ALPK3HCC1HumanLiverHCC1.42e-052.26e+000.5336
57538ALPK3Pt13.bHumanLiverHCC1.41e-025.34e-020.0251
57538ALPK3S014HumanLiverHCC2.68e-042.80e-010.2254
57538ALPK3S015HumanLiverHCC6.01e-094.43e-010.2375
57538ALPK3S016HumanLiverHCC2.13e-083.23e-010.2243
57538ALPK3S027HumanLiverHCC8.44e-129.00e-010.2446
57538ALPK3S028HumanLiverHCC1.80e-319.84e-010.2503
57538ALPK3S029HumanLiverHCC5.87e-228.27e-010.2581
Page: 1 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
EndometriumThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AEH: Atypical endometrial hyperplasia
EEC: Endometrioid Cancer
LiverThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.HCC: Hepatocellular carcinoma
NAFLD: Non-alcoholic fatty liver disease
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:00605376EndometriumAEHmuscle tissue development83/2100403/187232.57e-081.50e-0683
GO:00147065EndometriumAEHstriated muscle tissue development75/2100384/187231.06e-063.62e-0575
GO:00426925EndometriumAEHmuscle cell differentiation68/2100384/187238.88e-051.30e-0368
GO:00511465EndometriumAEHstriated muscle cell differentiation51/2100283/187234.20e-044.46e-0351
GO:0048738EndometriumAEHcardiac muscle tissue development43/2100236/187239.06e-048.30e-0343
GO:006053713EndometriumEECmuscle tissue development82/2168403/187232.14e-079.38e-0682
GO:001470612EndometriumEECstriated muscle tissue development74/2168384/187236.64e-061.57e-0474
GO:004269212EndometriumEECmuscle cell differentiation67/2168384/187233.87e-044.12e-0367
GO:005114613EndometriumEECstriated muscle cell differentiation51/2168283/187238.71e-047.97e-0351
GO:00487381EndometriumEECcardiac muscle tissue development42/2168236/187233.00e-032.10e-0242
Page: 1 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
ALPK3deletionFrame_Shift_Delc.2904delNp.Lys970AsnfsTer12p.K970Nfs*12Q96L96protein_codingTCGA-B5-A11H-01Endometriumuterine corpus endometrioid carcinomaFemale>=65III/IVHormone TherapymegaceSD
ALPK3deletionFrame_Shift_Delnovelc.4536_4566delCAAGGATCAGCGCCCAGTGGGCGAGGTGGGCp.Lys1513GlyfsTer19p.K1513Gfs*19Q96L96protein_codingTCGA-BG-A0M8-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIUnknownUnknownSD
ALPK3deletionFrame_Shift_Delc.2910delAp.Lys970AsnfsTer12p.K970Nfs*12Q96L96protein_codingTCGA-D1-A17A-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIUnknownUnknownSD
ALPK3insertionFrame_Shift_Insnovelc.4847dupGp.Gly1617TrpfsTer43p.G1617Wfs*43Q96L96protein_codingTCGA-DF-A2KY-01Endometriumuterine corpus endometrioid carcinomaFemale<65III/IVChemotherapycarboplatinSD
ALPK3deletionFrame_Shift_Delc.2904delNp.Lys970AsnfsTer12p.K970Nfs*12Q96L96protein_codingTCGA-DI-A1BU-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIChemotherapypaclitaxelSD
ALPK3SNVMissense_Mutationrs779689802c.4637A>Gp.Tyr1546Cysp.Y1546CQ96L96protein_codingdeleterious(0)probably_damaging(0.998)TCGA-4R-AA8I-01Liverliver hepatocellular carcinomaMale>=65I/IIUnknownUnknownPD
ALPK3SNVMissense_Mutationc.2781G>Tp.Glu927Aspp.E927DQ96L96protein_codingdeleterious_low_confidence(0.03)benign(0.021)TCGA-05-4250-01Lunglung adenocarcinomaFemale>=65III/IVUnknownUnknownSD
ALPK3SNVMissense_Mutationnovelc.1237N>Tp.Asp413Tyrp.D413YQ96L96protein_codingdeleterious(0)benign(0.292)TCGA-05-4398-01Lunglung adenocarcinomaFemale<65III/IVChemotherapycarboplatinCR
ALPK3SNVMissense_Mutationc.14N>Tp.Trp5Leup.W5LQ96L96protein_codingtolerated_low_confidence(0.2)benign(0)TCGA-05-4410-01Lunglung adenocarcinomaMale<65I/IIUnknownUnknownSD
ALPK3SNVMissense_Mutationc.2501N>Tp.Arg834Metp.R834MQ96L96protein_codingdeleterious_low_confidence(0.02)possibly_damaging(0.533)TCGA-44-2657-01Lunglung adenocarcinomaFemale>=65I/IIUnknownUnknownSD
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1