GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:0051656 | Colorectum | AD | establishment of organelle localization | 131/3918 | 390/18723 | 3.00e-09 | 2.06e-07 | 131 |
GO:0010639 | Colorectum | AD | negative regulation of organelle organization | 114/3918 | 348/18723 | 1.41e-07 | 6.49e-06 | 114 |
GO:0000910 | Colorectum | AD | cytokinesis | 59/3918 | 173/18723 | 3.74e-05 | 6.75e-04 | 59 |
GO:0061640 | Colorectum | AD | cytoskeleton-dependent cytokinesis | 37/3918 | 100/18723 | 1.58e-04 | 2.20e-03 | 37 |
GO:0033044 | Colorectum | AD | regulation of chromosome organization | 60/3918 | 187/18723 | 2.25e-04 | 2.94e-03 | 60 |
GO:0007063 | Colorectum | AD | regulation of sister chromatid cohesion | 12/3918 | 21/18723 | 3.02e-04 | 3.62e-03 | 12 |
GO:0007051 | Colorectum | AD | spindle organization | 58/3918 | 184/18723 | 4.71e-04 | 5.20e-03 | 58 |
GO:1902850 | Colorectum | AD | microtubule cytoskeleton organization involved in mitosis | 48/3918 | 147/18723 | 5.87e-04 | 6.21e-03 | 48 |
GO:0007062 | Colorectum | AD | sister chromatid cohesion | 23/3918 | 62/18723 | 2.51e-03 | 1.92e-02 | 23 |
GO:0000281 | Colorectum | AD | mitotic cytokinesis | 25/3918 | 71/18723 | 3.77e-03 | 2.65e-02 | 25 |
GO:0007346 | Colorectum | AD | regulation of mitotic cell cycle | 119/3918 | 457/18723 | 4.60e-03 | 3.14e-02 | 119 |
GO:0045787 | Colorectum | AD | positive regulation of cell cycle | 85/3918 | 313/18723 | 4.76e-03 | 3.22e-02 | 85 |
GO:0045842 | Colorectum | AD | positive regulation of mitotic metaphase/anaphase transition | 8/3918 | 15/18723 | 5.67e-03 | 3.64e-02 | 8 |
GO:1901970 | Colorectum | AD | positive regulation of mitotic sister chromatid separation | 8/3918 | 15/18723 | 5.67e-03 | 3.64e-02 | 8 |
GO:1905820 | Colorectum | AD | positive regulation of chromosome separation | 9/3918 | 18/18723 | 5.82e-03 | 3.67e-02 | 9 |
GO:0140014 | Colorectum | AD | mitotic nuclear division | 78/3918 | 287/18723 | 6.48e-03 | 4.05e-02 | 78 |
GO:0045931 | Colorectum | AD | positive regulation of mitotic cell cycle | 37/3918 | 121/18723 | 7.88e-03 | 4.73e-02 | 37 |
GO:00516561 | Colorectum | SER | establishment of organelle localization | 100/2897 | 390/18723 | 1.11e-07 | 6.79e-06 | 100 |
GO:00106391 | Colorectum | SER | negative regulation of organelle organization | 90/2897 | 348/18723 | 3.14e-07 | 1.69e-05 | 90 |
GO:00009101 | Colorectum | SER | cytokinesis | 45/2897 | 173/18723 | 2.28e-04 | 3.93e-03 | 45 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ESPL1 | SNV | Missense_Mutation | novel | c.6259N>C | p.Ala2087Pro | p.A2087P | Q14674 | protein_coding | deleterious(0) | probably_damaging(0.936) | TCGA-EC-A1NJ-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ESPL1 | SNV | Missense_Mutation | novel | c.122G>A | p.Arg41Gln | p.R41Q | Q14674 | protein_coding | tolerated(0.05) | benign(0.01) | TCGA-EO-A22R-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ESPL1 | SNV | Missense_Mutation | rs533105519 | c.820G>A | p.Ala274Thr | p.A274T | Q14674 | protein_coding | tolerated(0.22) | benign(0) | TCGA-EO-A22R-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ESPL1 | SNV | Missense_Mutation | novel | c.4663G>T | p.Asp1555Tyr | p.D1555Y | Q14674 | protein_coding | deleterious(0.04) | benign(0.36) | TCGA-EO-A22R-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ESPL1 | SNV | Missense_Mutation | novel | c.3139N>C | p.Cys1047Arg | p.C1047R | Q14674 | protein_coding | deleterious(0.01) | probably_damaging(0.942) | TCGA-EO-A22U-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ESPL1 | SNV | Missense_Mutation | novel | c.4837C>T | p.Pro1613Ser | p.P1613S | Q14674 | protein_coding | deleterious(0.01) | probably_damaging(0.999) | TCGA-FI-A2D5-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Chemotherapy | carboplatinum | PD |
ESPL1 | SNV | Missense_Mutation | novel | c.5993N>G | p.Tyr1998Cys | p.Y1998C | Q14674 | protein_coding | deleterious(0) | probably_damaging(1) | TCGA-FI-A2F4-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ESPL1 | SNV | Missense_Mutation | novel | c.3679T>C | p.Tyr1227His | p.Y1227H | Q14674 | protein_coding | deleterious(0.01) | benign(0.079) | TCGA-SL-A6JA-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ESPL1 | insertion | Frame_Shift_Ins | novel | c.2940dupA | p.Trp981MetfsTer23 | p.W981Mfs*23 | Q14674 | protein_coding | | | TCGA-B5-A1MX-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Hormone Therapy | megace | SD |
ESPL1 | deletion | In_Frame_Del | novel | c.1174_1197delTCTTTTCTTCAGATGTACTTTCAG | p.Ser392_Gln399del | p.S392_Q399del | Q14674 | protein_coding | | | TCGA-DF-A2KS-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | PD |