Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: ESPL1

Gene summary for ESPL1

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

ESPL1

Gene ID

9700

Gene nameextra spindle pole bodies like 1, separase
Gene AliasESP1
Cytomap12q13.13
Gene Typeprotein-coding
GO ID

GO:0000003

UniProtAcc

Q14674


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
9700ESPL1HTA11_3410_2000001011HumanColorectumAD3.47e-031.09e-010.0155
9700ESPL1HTA11_2487_2000001011HumanColorectumSER3.87e-021.40e-01-0.1808
9700ESPL1HTA11_2951_2000001011HumanColorectumAD3.40e-021.89e-010.0216
9700ESPL1HTA11_1938_2000001011HumanColorectumAD5.27e-052.06e-01-0.0811
9700ESPL1HTA11_347_2000001011HumanColorectumAD2.18e-102.28e-01-0.1954
9700ESPL1HTA11_696_2000001011HumanColorectumAD6.52e-184.79e-01-0.1464
9700ESPL1HTA11_1391_2000001011HumanColorectumAD9.45e-061.72e-01-0.059
9700ESPL1HTA11_2992_2000001011HumanColorectumSER2.31e-084.40e-01-0.1706
9700ESPL1HTA11_5216_2000001011HumanColorectumSER3.40e-032.77e-01-0.1462
9700ESPL1HTA11_546_2000001011HumanColorectumAD1.44e-032.11e-01-0.0842
9700ESPL1HTA11_99999965104_69814HumanColorectumMSS3.26e-041.65e-010.281
Page: 1 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
Colorectum (GSE201348)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.FAP: Familial adenomatous polyposis
CRC: Colorectal cancer
Colorectum (HTA11)The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AD: Adenomas
SER: Sessile serrated lesions
MSI-H: Microsatellite-high colorectal cancer
MSS: Microsatellite stable colorectal cancer
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
ColorectumADGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumSERGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSSGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumMSI-HGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ColorectumFAPGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:0051656ColorectumADestablishment of organelle localization131/3918390/187233.00e-092.06e-07131
GO:0010639ColorectumADnegative regulation of organelle organization114/3918348/187231.41e-076.49e-06114
GO:0000910ColorectumADcytokinesis59/3918173/187233.74e-056.75e-0459
GO:0061640ColorectumADcytoskeleton-dependent cytokinesis37/3918100/187231.58e-042.20e-0337
GO:0033044ColorectumADregulation of chromosome organization60/3918187/187232.25e-042.94e-0360
GO:0007063ColorectumADregulation of sister chromatid cohesion12/391821/187233.02e-043.62e-0312
GO:0007051ColorectumADspindle organization58/3918184/187234.71e-045.20e-0358
GO:1902850ColorectumADmicrotubule cytoskeleton organization involved in mitosis48/3918147/187235.87e-046.21e-0348
GO:0007062ColorectumADsister chromatid cohesion23/391862/187232.51e-031.92e-0223
GO:0000281ColorectumADmitotic cytokinesis25/391871/187233.77e-032.65e-0225
GO:0007346ColorectumADregulation of mitotic cell cycle119/3918457/187234.60e-033.14e-02119
GO:0045787ColorectumADpositive regulation of cell cycle85/3918313/187234.76e-033.22e-0285
GO:0045842ColorectumADpositive regulation of mitotic metaphase/anaphase transition8/391815/187235.67e-033.64e-028
GO:1901970ColorectumADpositive regulation of mitotic sister chromatid separation8/391815/187235.67e-033.64e-028
GO:1905820ColorectumADpositive regulation of chromosome separation9/391818/187235.82e-033.67e-029
GO:0140014ColorectumADmitotic nuclear division78/3918287/187236.48e-034.05e-0278
GO:0045931ColorectumADpositive regulation of mitotic cell cycle37/3918121/187237.88e-034.73e-0237
GO:00516561ColorectumSERestablishment of organelle localization100/2897390/187231.11e-076.79e-06100
GO:00106391ColorectumSERnegative regulation of organelle organization90/2897348/187233.14e-071.69e-0590
GO:00009101ColorectumSERcytokinesis45/2897173/187232.28e-043.93e-0345
Page: 1 2 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
hsa05166ColorectumADHuman T-cell leukemia virus 1 infection72/2092222/84655.24e-032.44e-021.55e-0272
hsa051661ColorectumADHuman T-cell leukemia virus 1 infection72/2092222/84655.24e-032.44e-021.55e-0272
hsa051662ColorectumMSSHuman T-cell leukemia virus 1 infection68/1875222/84651.84e-039.61e-035.89e-0368
hsa051663ColorectumMSSHuman T-cell leukemia virus 1 infection68/1875222/84651.84e-039.61e-035.89e-0368
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
ESPL1SNVMissense_Mutationnovelc.6259N>Cp.Ala2087Prop.A2087PQ14674protein_codingdeleterious(0)probably_damaging(0.936)TCGA-EC-A1NJ-01Endometriumuterine corpus endometrioid carcinomaFemale>=65I/IIUnknownUnknownSD
ESPL1SNVMissense_Mutationnovelc.122G>Ap.Arg41Glnp.R41QQ14674protein_codingtolerated(0.05)benign(0.01)TCGA-EO-A22R-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIUnknownUnknownSD
ESPL1SNVMissense_Mutationrs533105519c.820G>Ap.Ala274Thrp.A274TQ14674protein_codingtolerated(0.22)benign(0)TCGA-EO-A22R-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIUnknownUnknownSD
ESPL1SNVMissense_Mutationnovelc.4663G>Tp.Asp1555Tyrp.D1555YQ14674protein_codingdeleterious(0.04)benign(0.36)TCGA-EO-A22R-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIUnknownUnknownSD
ESPL1SNVMissense_Mutationnovelc.3139N>Cp.Cys1047Argp.C1047RQ14674protein_codingdeleterious(0.01)probably_damaging(0.942)TCGA-EO-A22U-01Endometriumuterine corpus endometrioid carcinomaFemale>=65I/IIUnknownUnknownSD
ESPL1SNVMissense_Mutationnovelc.4837C>Tp.Pro1613Serp.P1613SQ14674protein_codingdeleterious(0.01)probably_damaging(0.999)TCGA-FI-A2D5-01Endometriumuterine corpus endometrioid carcinomaFemale<65III/IVChemotherapycarboplatinumPD
ESPL1SNVMissense_Mutationnovelc.5993N>Gp.Tyr1998Cysp.Y1998CQ14674protein_codingdeleterious(0)probably_damaging(1)TCGA-FI-A2F4-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIUnknownUnknownSD
ESPL1SNVMissense_Mutationnovelc.3679T>Cp.Tyr1227Hisp.Y1227HQ14674protein_codingdeleterious(0.01)benign(0.079)TCGA-SL-A6JA-01Endometriumuterine corpus endometrioid carcinomaFemale>=65I/IIUnknownUnknownSD
ESPL1insertionFrame_Shift_Insnovelc.2940dupAp.Trp981MetfsTer23p.W981Mfs*23Q14674protein_codingTCGA-B5-A1MX-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIHormone TherapymegaceSD
ESPL1deletionIn_Frame_Delnovelc.1174_1197delTCTTTTCTTCAGATGTACTTTCAGp.Ser392_Gln399delp.S392_Q399delQ14674protein_codingTCGA-DF-A2KS-01Endometriumuterine corpus endometrioid carcinomaFemale>=65I/IIUnknownUnknownPD
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1