![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: ADGRF4 |
Gene summary for ADGRF4 |
![]() |
Gene information | Species | Human | Gene symbol | ADGRF4 | Gene ID | 221393 |
Gene name | adhesion G protein-coupled receptor F4 | |
Gene Alias | GPR115 | |
Cytomap | 6p12.3 | |
Gene Type | protein-coding | GO ID | GO:0007154 | UniProtAcc | Q8IZF3 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
221393 | ADGRF4 | P31T-E | Human | Esophagus | ESCC | 6.19e-03 | 1.47e-01 | 0.1251 |
221393 | ADGRF4 | P37T-E | Human | Esophagus | ESCC | 2.67e-02 | 6.23e-02 | 0.1371 |
221393 | ADGRF4 | P44T-E | Human | Esophagus | ESCC | 6.06e-03 | 1.59e-01 | 0.1096 |
221393 | ADGRF4 | P47T-E | Human | Esophagus | ESCC | 8.35e-04 | 9.76e-02 | 0.1067 |
221393 | ADGRF4 | P49T-E | Human | Esophagus | ESCC | 2.63e-03 | 5.04e-01 | 0.1768 |
221393 | ADGRF4 | P61T-E | Human | Esophagus | ESCC | 3.13e-02 | 1.86e-01 | 0.099 |
221393 | ADGRF4 | P62T-E | Human | Esophagus | ESCC | 2.51e-02 | 1.10e-01 | 0.1302 |
221393 | ADGRF4 | P65T-E | Human | Esophagus | ESCC | 1.48e-02 | 1.16e-01 | 0.0978 |
221393 | ADGRF4 | P75T-E | Human | Esophagus | ESCC | 2.55e-04 | 1.43e-01 | 0.1125 |
221393 | ADGRF4 | P80T-E | Human | Esophagus | ESCC | 5.61e-27 | 1.00e+00 | 0.155 |
221393 | ADGRF4 | P130T-E | Human | Esophagus | ESCC | 8.86e-18 | 4.12e-01 | 0.1676 |
Page: 1 |
![]() |
Tissue | Expression Dynamics | Abbreviation |
Esophagus | ![]() | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias | ||
LGIN: Low-grade intraepithelial neoplasias |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ADGRF4 | insertion | Frame_Shift_Ins | novel | c.1308_1309insT | p.Tyr437LeufsTer28 | p.Y437Lfs*28 | Q8IZF3 | protein_coding | TCGA-BA-4074-01 | Oral cavity | head & neck squamous cell carcinoma | Male | >=65 | I/II | Chemotherapy | carboplatin | PD | ||
ADGRF4 | SNV | Missense_Mutation | rs145102054 | c.1285N>T | p.Arg429Trp | p.R429W | Q8IZF3 | protein_coding | deleterious(0.01) | probably_damaging(0.971) | TCGA-J9-A52C-01 | Prostate | prostate adenocarcinoma | Male | <65 | 9 | Unknown | Unknown | SD |
ADGRF4 | SNV | Missense_Mutation | c.481N>A | p.Ala161Thr | p.A161T | Q8IZF3 | protein_coding | deleterious(0.01) | probably_damaging(0.983) | TCGA-ZG-A9LB-01 | Prostate | prostate adenocarcinoma | Male | >=65 | 9 | Unknown | Unknown | SD | |
ADGRF4 | SNV | Missense_Mutation | c.1711N>A | p.Ala571Thr | p.A571T | Q8IZF3 | protein_coding | deleterious(0.04) | probably_damaging(0.978) | TCGA-CG-4442-01 | Stomach | stomach adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD | |
ADGRF4 | SNV | Missense_Mutation | rs146828294 | c.1298N>T | p.Thr433Met | p.T433M | Q8IZF3 | protein_coding | deleterious(0.02) | probably_damaging(0.999) | TCGA-F1-6177-01 | Stomach | stomach adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
ADGRF4 | SNV | Missense_Mutation | novel | c.1291G>T | p.Val431Phe | p.V431F | Q8IZF3 | protein_coding | deleterious(0) | possibly_damaging(0.828) | TCGA-VQ-A925-01 | Stomach | stomach adenocarcinoma | Male | >=65 | III/IV | Unknown | Unknown | PD |
ADGRF4 | SNV | Missense_Mutation | rs547273598 | c.1697N>T | p.Ala566Val | p.A566V | Q8IZF3 | protein_coding | deleterious(0.01) | possibly_damaging(0.503) | TCGA-VQ-A94R-01 | Stomach | stomach adenocarcinoma | Male | <65 | III/IV | Chemotherapy | fluorouracil | PD |
ADGRF4 | deletion | Frame_Shift_Del | novel | c.1466delT | p.Phe489SerfsTer21 | p.F489Sfs*21 | Q8IZF3 | protein_coding | TCGA-BR-4361-01 | Stomach | stomach adenocarcinoma | Female | >=65 | III/IV | Unknown | Unknown | SD | ||
ADGRF4 | insertion | Frame_Shift_Ins | novel | c.585_639dupCACAGCAGCCATTTCAAACTGGGCTTTCATTCCCAACAAAAATGCCAGCTCGGAT | p.Leu214HisfsTer35 | p.L214Hfs*35 | Q8IZF3 | protein_coding | TCGA-VQ-A91Z-01 | Stomach | stomach adenocarcinoma | Female | >=65 | III/IV | Chemotherapy | fluorouracil | PD |
Page: 1 2 3 4 5 6 7 8 9 10 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |