![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: SNRPF |
Gene summary for SNRPF |
![]() |
Gene information | Species | Human | Gene symbol | SNRPF | Gene ID | 6636 |
Gene name | small nuclear ribonucleoprotein polypeptide F | |
Gene Alias | SMF | |
Cytomap | 12q23.1 | |
Gene Type | protein-coding | GO ID | GO:0000375 | UniProtAcc | P62306 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
6636 | SNRPF | GSM4909282 | Human | Breast | IDC | 3.09e-04 | 3.45e-01 | -0.0288 |
6636 | SNRPF | GSM4909285 | Human | Breast | IDC | 2.74e-16 | 4.99e-01 | 0.21 |
6636 | SNRPF | GSM4909286 | Human | Breast | IDC | 2.29e-06 | 3.97e-01 | 0.1081 |
6636 | SNRPF | GSM4909288 | Human | Breast | IDC | 1.28e-02 | 1.49e-01 | 0.0988 |
6636 | SNRPF | GSM4909290 | Human | Breast | IDC | 8.41e-04 | 4.14e-01 | 0.2096 |
6636 | SNRPF | GSM4909293 | Human | Breast | IDC | 1.06e-04 | 3.36e-01 | 0.1581 |
6636 | SNRPF | GSM4909294 | Human | Breast | IDC | 6.19e-29 | 5.52e-01 | 0.2022 |
6636 | SNRPF | GSM4909296 | Human | Breast | IDC | 7.11e-21 | 2.55e-01 | 0.1524 |
6636 | SNRPF | GSM4909297 | Human | Breast | IDC | 2.15e-23 | -3.52e-02 | 0.1517 |
6636 | SNRPF | GSM4909301 | Human | Breast | IDC | 7.23e-05 | 2.73e-01 | 0.1577 |
6636 | SNRPF | GSM4909304 | Human | Breast | IDC | 1.08e-05 | 2.75e-01 | 0.1636 |
6636 | SNRPF | GSM4909309 | Human | Breast | IDC | 1.42e-06 | 1.50e-01 | 0.0483 |
6636 | SNRPF | GSM4909311 | Human | Breast | IDC | 4.71e-38 | -3.01e-01 | 0.1534 |
6636 | SNRPF | GSM4909312 | Human | Breast | IDC | 4.74e-14 | -1.61e-01 | 0.1552 |
6636 | SNRPF | GSM4909313 | Human | Breast | IDC | 1.18e-05 | -1.93e-01 | 0.0391 |
6636 | SNRPF | GSM4909315 | Human | Breast | IDC | 8.95e-23 | 5.84e-01 | 0.21 |
6636 | SNRPF | GSM4909316 | Human | Breast | IDC | 3.04e-11 | 5.03e-01 | 0.21 |
6636 | SNRPF | GSM4909318 | Human | Breast | IDC | 1.67e-02 | 3.99e-01 | 0.2031 |
6636 | SNRPF | GSM4909319 | Human | Breast | IDC | 8.99e-48 | -3.46e-01 | 0.1563 |
6636 | SNRPF | GSM4909320 | Human | Breast | IDC | 8.73e-06 | -2.27e-01 | 0.1575 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00226139 | Breast | Precancer | ribonucleoprotein complex biogenesis | 79/1080 | 463/18723 | 2.11e-18 | 1.03e-15 | 79 |
GO:00718269 | Breast | Precancer | ribonucleoprotein complex subunit organization | 48/1080 | 227/18723 | 2.68e-15 | 8.45e-13 | 48 |
GO:00226189 | Breast | Precancer | ribonucleoprotein complex assembly | 47/1080 | 220/18723 | 3.47e-15 | 1.03e-12 | 47 |
GO:00083809 | Breast | Precancer | RNA splicing | 65/1080 | 434/18723 | 1.27e-12 | 2.53e-10 | 65 |
GO:00003759 | Breast | Precancer | RNA splicing, via transesterification reactions | 52/1080 | 324/18723 | 1.74e-11 | 2.22e-09 | 52 |
GO:00003779 | Breast | Precancer | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 51/1080 | 320/18723 | 3.55e-11 | 4.04e-09 | 51 |
GO:00003989 | Breast | Precancer | mRNA splicing, via spliceosome | 51/1080 | 320/18723 | 3.55e-11 | 4.04e-09 | 51 |
GO:00003873 | Breast | Precancer | spliceosomal snRNP assembly | 10/1080 | 50/18723 | 4.86e-04 | 6.35e-03 | 10 |
GO:002261314 | Breast | IDC | ribonucleoprotein complex biogenesis | 83/1434 | 463/18723 | 2.01e-13 | 5.20e-11 | 83 |
GO:007182614 | Breast | IDC | ribonucleoprotein complex subunit organization | 52/1434 | 227/18723 | 5.18e-13 | 1.21e-10 | 52 |
GO:002261814 | Breast | IDC | ribonucleoprotein complex assembly | 51/1434 | 220/18723 | 5.32e-13 | 1.21e-10 | 51 |
GO:000838014 | Breast | IDC | RNA splicing | 73/1434 | 434/18723 | 1.27e-10 | 1.57e-08 | 73 |
GO:000037514 | Breast | IDC | RNA splicing, via transesterification reactions | 58/1434 | 324/18723 | 9.44e-10 | 9.58e-08 | 58 |
GO:000037714 | Breast | IDC | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 57/1434 | 320/18723 | 1.60e-09 | 1.49e-07 | 57 |
GO:000039814 | Breast | IDC | mRNA splicing, via spliceosome | 57/1434 | 320/18723 | 1.60e-09 | 1.49e-07 | 57 |
GO:000038711 | Breast | IDC | spliceosomal snRNP assembly | 11/1434 | 50/18723 | 1.18e-03 | 1.28e-02 | 11 |
GO:002261324 | Breast | DCIS | ribonucleoprotein complex biogenesis | 83/1390 | 463/18723 | 3.65e-14 | 1.09e-11 | 83 |
GO:007182624 | Breast | DCIS | ribonucleoprotein complex subunit organization | 52/1390 | 227/18723 | 1.54e-13 | 3.95e-11 | 52 |
GO:002261824 | Breast | DCIS | ribonucleoprotein complex assembly | 51/1390 | 220/18723 | 1.60e-13 | 3.95e-11 | 51 |
GO:000838024 | Breast | DCIS | RNA splicing | 73/1390 | 434/18723 | 3.05e-11 | 5.08e-09 | 73 |
Page: 1 2 3 4 5 6 7 8 9 10 11 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa0304022 | Liver | HCC | Spliceosome | 122/4020 | 217/8465 | 5.55e-03 | 1.60e-02 | 8.91e-03 | 122 |
hsa0304032 | Liver | HCC | Spliceosome | 122/4020 | 217/8465 | 5.55e-03 | 1.60e-02 | 8.91e-03 | 122 |
hsa0304042 | Liver | Cyst | Spliceosome | 19/339 | 217/8465 | 1.10e-03 | 1.22e-02 | 1.00e-02 | 19 |
hsa0304052 | Liver | Cyst | Spliceosome | 19/339 | 217/8465 | 1.10e-03 | 1.22e-02 | 1.00e-02 | 19 |
hsa0304016 | Oral cavity | OSCC | Spliceosome | 123/3704 | 217/8465 | 7.21e-05 | 2.74e-04 | 1.40e-04 | 123 |
hsa0304017 | Oral cavity | OSCC | Spliceosome | 123/3704 | 217/8465 | 7.21e-05 | 2.74e-04 | 1.40e-04 | 123 |
hsa0304026 | Oral cavity | LP | Spliceosome | 106/2418 | 217/8465 | 1.30e-10 | 2.40e-09 | 1.55e-09 | 106 |
hsa0304036 | Oral cavity | LP | Spliceosome | 106/2418 | 217/8465 | 1.30e-10 | 2.40e-09 | 1.55e-09 | 106 |
hsa0304010 | Prostate | BPH | Spliceosome | 62/1718 | 217/8465 | 1.99e-03 | 7.92e-03 | 4.90e-03 | 62 |
hsa0304015 | Prostate | BPH | Spliceosome | 62/1718 | 217/8465 | 1.99e-03 | 7.92e-03 | 4.90e-03 | 62 |
hsa0304025 | Prostate | Tumor | Spliceosome | 66/1791 | 217/8465 | 7.53e-04 | 3.59e-03 | 2.23e-03 | 66 |
hsa0304035 | Prostate | Tumor | Spliceosome | 66/1791 | 217/8465 | 7.53e-04 | 3.59e-03 | 2.23e-03 | 66 |
hsa0304041 | Stomach | SIM | Spliceosome | 23/465 | 217/8465 | 1.81e-03 | 1.34e-02 | 1.08e-02 | 23 |
hsa0304051 | Stomach | SIM | Spliceosome | 23/465 | 217/8465 | 1.81e-03 | 1.34e-02 | 1.08e-02 | 23 |
Page: 1 2 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
SNRPF | SNV | Missense_Mutation | novel | c.52N>T | p.Pro18Ser | p.P18S | P62306 | protein_coding | tolerated(0.17) | benign(0.021) | TCGA-AP-A1DK-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
SNRPF | SNV | Missense_Mutation | novel | c.119T>C | p.Met40Thr | p.M40T | P62306 | protein_coding | deleterious(0) | probably_damaging(0.978) | TCGA-EO-A22R-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
SNRPF | deletion | In_Frame_Del | novel | c.62_82delTGAAACTTAAGTGGGGAATGG | p.Val21_Met27del | p.V21_M27del | P62306 | protein_coding | TCGA-CC-A7IJ-01 | Liver | liver hepatocellular carcinoma | Male | <65 | I/II | Unknown | Unknown | SD | ||
SNRPF | SNV | Missense_Mutation | c.169N>A | p.Gly57Arg | p.G57R | P62306 | protein_coding | deleterious(0.01) | possibly_damaging(0.77) | TCGA-33-6737-01 | Lung | lung squamous cell carcinoma | Male | >=65 | III/IV | Chemotherapy | gemcitabine | PD |
Page: 1 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |