Tissue | Expression Dynamics | Abbreviation |
Breast | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Breast/ZFP36L1_pca_on_diff_genes.png) | IDC: Invasive ductal carcinoma |
DCIS: Ductal carcinoma in situ |
Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers |
Cervix | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Cervix/ZFP36L1_pca_on_diff_genes.png) | CC: Cervix cancer |
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions |
N_HPV: HPV-infected normal cervix |
Colorectum (GSE201348) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Becker/ZFP36L1_pca_on_diff_genes.png) | FAP: Familial adenomatous polyposis |
CRC: Colorectal cancer |
Colorectum (HTA11) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Chen/ZFP36L1_pca_on_diff_genes.png) | AD: Adenomas |
SER: Sessile serrated lesions |
MSI-H: Microsatellite-high colorectal cancer |
MSS: Microsatellite stable colorectal cancer |
Endometrium | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Endometrium/ZFP36L1_pca_on_diff_genes.png) | AEH: Atypical endometrial hyperplasia |
EEC: Endometrioid Cancer |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/ZFP36L1_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Liver/ZFP36L1_pca_on_diff_genes.png) | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Lung | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Lung/ZFP36L1_pca_on_diff_genes.png) | AAH: Atypical adenomatous hyperplasia |
AIS: Adenocarcinoma in situ |
IAC: Invasive lung adenocarcinoma |
MIA: Minimally invasive adenocarcinoma |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/ZFP36L1_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Prostate | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Prostate/ZFP36L1_pca_on_diff_genes.png) | BPH: Benign Prostatic Hyperplasia |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/ZFP36L1_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/ZFP36L1_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:190331117 | Prostate | Tumor | regulation of mRNA metabolic process | 111/3246 | 288/18723 | 6.66e-18 | 2.30e-15 | 111 |
GO:005068416 | Prostate | Tumor | regulation of mRNA processing | 64/3246 | 137/18723 | 1.55e-15 | 2.75e-13 | 64 |
GO:004854519 | Prostate | Tumor | response to steroid hormone | 118/3246 | 339/18723 | 4.46e-15 | 6.94e-13 | 118 |
GO:000989619 | Prostate | Tumor | positive regulation of catabolic process | 155/3246 | 492/18723 | 5.62e-15 | 8.52e-13 | 155 |
GO:000640217 | Prostate | Tumor | mRNA catabolic process | 87/3246 | 232/18723 | 1.56e-13 | 1.73e-11 | 87 |
GO:003133119 | Prostate | Tumor | positive regulation of cellular catabolic process | 134/3246 | 427/18723 | 5.54e-13 | 5.84e-11 | 134 |
GO:006219719 | Prostate | Tumor | cellular response to chemical stress | 112/3246 | 337/18723 | 7.53e-13 | 7.67e-11 | 112 |
GO:006145816 | Prostate | Tumor | reproductive system development | 133/3246 | 427/18723 | 1.24e-12 | 1.15e-10 | 133 |
GO:004860815 | Prostate | Tumor | reproductive structure development | 131/3246 | 424/18723 | 3.48e-12 | 2.89e-10 | 131 |
GO:003009919 | Prostate | Tumor | myeloid cell differentiation | 120/3246 | 381/18723 | 6.96e-12 | 5.62e-10 | 120 |
GO:007138317 | Prostate | Tumor | cellular response to steroid hormone stimulus | 76/3246 | 204/18723 | 7.73e-12 | 6.16e-10 | 76 |
GO:000640117 | Prostate | Tumor | RNA catabolic process | 94/3246 | 278/18723 | 1.77e-11 | 1.25e-09 | 94 |
GO:003410119 | Prostate | Tumor | erythrocyte homeostasis | 54/3246 | 129/18723 | 5.07e-11 | 3.32e-09 | 54 |
GO:003021819 | Prostate | Tumor | erythrocyte differentiation | 50/3246 | 120/18723 | 3.17e-10 | 1.70e-08 | 50 |
GO:000226219 | Prostate | Tumor | myeloid cell homeostasis | 60/3246 | 157/18723 | 3.72e-10 | 1.97e-08 | 60 |
GO:000640317 | Prostate | Tumor | RNA localization | 70/3246 | 201/18723 | 1.58e-09 | 7.32e-08 | 70 |
GO:005067316 | Prostate | Tumor | epithelial cell proliferation | 125/3246 | 437/18723 | 2.56e-09 | 1.08e-07 | 125 |
GO:000095615 | Prostate | Tumor | nuclear-transcribed mRNA catabolic process | 46/3246 | 112/18723 | 2.80e-09 | 1.17e-07 | 46 |
GO:004887219 | Prostate | Tumor | homeostasis of number of cells | 86/3246 | 272/18723 | 5.29e-09 | 2.11e-07 | 86 |
GO:005067815 | Prostate | Tumor | regulation of epithelial cell proliferation | 110/3246 | 381/18723 | 1.32e-08 | 4.82e-07 | 110 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ZFP36L1 | SNV | Missense_Mutation | novel | c.506N>C | p.Tyr169Ser | p.Y169S | Q07352 | protein_coding | deleterious(0.01) | probably_damaging(0.998) | TCGA-A8-A07F-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | tamoxiphen | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.34N>A | p.Asp12Asn | p.D12N | Q07352 | protein_coding | deleterious(0) | benign(0.114) | TCGA-B6-A0RS-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
ZFP36L1 | deletion | In_Frame_Del | | c.526_528delNNN | p.Ile176del | p.I176del | Q07352 | protein_coding | | | TCGA-A2-A0T4-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | femara | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.125_126insG | p.Thr43HisfsTer32 | p.T43Hfs*32 | Q07352 | protein_coding | | | TCGA-AN-A03X-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.907_908insG | p.Glu303GlyfsTer36 | p.E303Gfs*36 | Q07352 | protein_coding | | | TCGA-AN-A0AM-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | deletion | Frame_Shift_Del | | c.943_989delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | p.Gly315GlnfsTer8 | p.G315Qfs*8 | Q07352 | protein_coding | | | TCGA-AN-A0FJ-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.677_678insAGCCCCACGTCCAT | p.Thr227AlafsTer11 | p.T227Afs*11 | Q07352 | protein_coding | | | TCGA-BH-A0B0-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | CR |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.98_99insG | p.Cys34LeufsTer41 | p.C34Lfs*41 | Q07352 | protein_coding | | | TCGA-GM-A2DC-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | xeloda | CR |
ZFP36L1 | deletion | Frame_Shift_Del | novel | c.345_375delCAAGACGGAGCTGTGCCGCCCCTTTGAGGAA | p.Tyr115Ter | p.Y115* | Q07352 | protein_coding | | | TCGA-LD-A7W6-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | letrozole | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.476N>A | p.Arg159His | p.R159H | Q07352 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-2W-A8YY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |