Tissue | Expression Dynamics | Abbreviation |
Breast | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Breast/ZFP36L1_pca_on_diff_genes.png) | IDC: Invasive ductal carcinoma |
DCIS: Ductal carcinoma in situ |
Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers |
Cervix | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Cervix/ZFP36L1_pca_on_diff_genes.png) | CC: Cervix cancer |
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions |
N_HPV: HPV-infected normal cervix |
Colorectum (GSE201348) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Becker/ZFP36L1_pca_on_diff_genes.png) | FAP: Familial adenomatous polyposis |
CRC: Colorectal cancer |
Colorectum (HTA11) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Chen/ZFP36L1_pca_on_diff_genes.png) | AD: Adenomas |
SER: Sessile serrated lesions |
MSI-H: Microsatellite-high colorectal cancer |
MSS: Microsatellite stable colorectal cancer |
Endometrium | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Endometrium/ZFP36L1_pca_on_diff_genes.png) | AEH: Atypical endometrial hyperplasia |
EEC: Endometrioid Cancer |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/ZFP36L1_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Liver/ZFP36L1_pca_on_diff_genes.png) | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Lung | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Lung/ZFP36L1_pca_on_diff_genes.png) | AAH: Atypical adenomatous hyperplasia |
AIS: Adenocarcinoma in situ |
IAC: Invasive lung adenocarcinoma |
MIA: Minimally invasive adenocarcinoma |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/ZFP36L1_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Prostate | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Prostate/ZFP36L1_pca_on_diff_genes.png) | BPH: Benign Prostatic Hyperplasia |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/ZFP36L1_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/ZFP36L1_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:006101415 | Oral cavity | LP | positive regulation of mRNA catabolic process | 32/4623 | 87/18723 | 7.97e-03 | 4.38e-02 | 32 |
GO:190370619 | Oral cavity | LP | regulation of hemopoiesis | 111/4623 | 367/18723 | 8.48e-03 | 4.60e-02 | 111 |
GO:190331133 | Oral cavity | NEOLP | regulation of mRNA metabolic process | 91/2005 | 288/18723 | 2.65e-22 | 7.88e-19 | 91 |
GO:005068433 | Oral cavity | NEOLP | regulation of mRNA processing | 56/2005 | 137/18723 | 4.37e-20 | 6.48e-17 | 56 |
GO:000989633 | Oral cavity | NEOLP | positive regulation of catabolic process | 111/2005 | 492/18723 | 1.19e-14 | 4.72e-12 | 111 |
GO:003133133 | Oral cavity | NEOLP | positive regulation of cellular catabolic process | 97/2005 | 427/18723 | 3.77e-13 | 1.07e-10 | 97 |
GO:000640232 | Oral cavity | NEOLP | mRNA catabolic process | 62/2005 | 232/18723 | 5.51e-12 | 9.91e-10 | 62 |
GO:003410133 | Oral cavity | NEOLP | erythrocyte homeostasis | 41/2005 | 129/18723 | 6.76e-11 | 7.87e-09 | 41 |
GO:006145831 | Oral cavity | NEOLP | reproductive system development | 91/2005 | 427/18723 | 8.18e-11 | 9.00e-09 | 91 |
GO:000641734 | Oral cavity | NEOLP | regulation of translation | 97/2005 | 468/18723 | 9.94e-11 | 1.05e-08 | 97 |
GO:000226233 | Oral cavity | NEOLP | myeloid cell homeostasis | 46/2005 | 157/18723 | 1.07e-10 | 1.12e-08 | 46 |
GO:004860831 | Oral cavity | NEOLP | reproductive structure development | 90/2005 | 424/18723 | 1.30e-10 | 1.33e-08 | 90 |
GO:003009932 | Oral cavity | NEOLP | myeloid cell differentiation | 83/2005 | 381/18723 | 1.79e-10 | 1.69e-08 | 83 |
GO:004887233 | Oral cavity | NEOLP | homeostasis of number of cells | 65/2005 | 272/18723 | 3.20e-10 | 2.93e-08 | 65 |
GO:006219733 | Oral cavity | NEOLP | cellular response to chemical stress | 75/2005 | 337/18723 | 4.87e-10 | 3.97e-08 | 75 |
GO:190165331 | Oral cavity | NEOLP | cellular response to peptide | 78/2005 | 359/18723 | 7.21e-10 | 5.54e-08 | 78 |
GO:000189031 | Oral cavity | NEOLP | placenta development | 42/2005 | 144/18723 | 8.01e-10 | 6.02e-08 | 42 |
GO:003021832 | Oral cavity | NEOLP | erythrocyte differentiation | 37/2005 | 120/18723 | 1.47e-09 | 1.01e-07 | 37 |
GO:006101332 | Oral cavity | NEOLP | regulation of mRNA catabolic process | 45/2005 | 166/18723 | 2.67e-09 | 1.64e-07 | 45 |
GO:000640131 | Oral cavity | NEOLP | RNA catabolic process | 63/2005 | 278/18723 | 5.63e-09 | 3.07e-07 | 63 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ZFP36L1 | SNV | Missense_Mutation | novel | c.506N>C | p.Tyr169Ser | p.Y169S | Q07352 | protein_coding | deleterious(0.01) | probably_damaging(0.998) | TCGA-A8-A07F-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | tamoxiphen | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.34N>A | p.Asp12Asn | p.D12N | Q07352 | protein_coding | deleterious(0) | benign(0.114) | TCGA-B6-A0RS-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
ZFP36L1 | deletion | In_Frame_Del | | c.526_528delNNN | p.Ile176del | p.I176del | Q07352 | protein_coding | | | TCGA-A2-A0T4-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | femara | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.125_126insG | p.Thr43HisfsTer32 | p.T43Hfs*32 | Q07352 | protein_coding | | | TCGA-AN-A03X-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.907_908insG | p.Glu303GlyfsTer36 | p.E303Gfs*36 | Q07352 | protein_coding | | | TCGA-AN-A0AM-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | deletion | Frame_Shift_Del | | c.943_989delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | p.Gly315GlnfsTer8 | p.G315Qfs*8 | Q07352 | protein_coding | | | TCGA-AN-A0FJ-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.677_678insAGCCCCACGTCCAT | p.Thr227AlafsTer11 | p.T227Afs*11 | Q07352 | protein_coding | | | TCGA-BH-A0B0-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | CR |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.98_99insG | p.Cys34LeufsTer41 | p.C34Lfs*41 | Q07352 | protein_coding | | | TCGA-GM-A2DC-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | xeloda | CR |
ZFP36L1 | deletion | Frame_Shift_Del | novel | c.345_375delCAAGACGGAGCTGTGCCGCCCCTTTGAGGAA | p.Tyr115Ter | p.Y115* | Q07352 | protein_coding | | | TCGA-LD-A7W6-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | letrozole | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.476N>A | p.Arg159His | p.R159H | Q07352 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-2W-A8YY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |