Tissue | Expression Dynamics | Abbreviation |
Breast | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Breast/ZFP36L1_pca_on_diff_genes.png) | IDC: Invasive ductal carcinoma |
DCIS: Ductal carcinoma in situ |
Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers |
Cervix | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Cervix/ZFP36L1_pca_on_diff_genes.png) | CC: Cervix cancer |
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions |
N_HPV: HPV-infected normal cervix |
Colorectum (GSE201348) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Becker/ZFP36L1_pca_on_diff_genes.png) | FAP: Familial adenomatous polyposis |
CRC: Colorectal cancer |
Colorectum (HTA11) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Chen/ZFP36L1_pca_on_diff_genes.png) | AD: Adenomas |
SER: Sessile serrated lesions |
MSI-H: Microsatellite-high colorectal cancer |
MSS: Microsatellite stable colorectal cancer |
Endometrium | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Endometrium/ZFP36L1_pca_on_diff_genes.png) | AEH: Atypical endometrial hyperplasia |
EEC: Endometrioid Cancer |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/ZFP36L1_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Liver/ZFP36L1_pca_on_diff_genes.png) | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Lung | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Lung/ZFP36L1_pca_on_diff_genes.png) | AAH: Atypical adenomatous hyperplasia |
AIS: Adenocarcinoma in situ |
IAC: Invasive lung adenocarcinoma |
MIA: Minimally invasive adenocarcinoma |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/ZFP36L1_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Prostate | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Prostate/ZFP36L1_pca_on_diff_genes.png) | BPH: Benign Prostatic Hyperplasia |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/ZFP36L1_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/ZFP36L1_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:003022414 | Oral cavity | OSCC | monocyte differentiation | 23/7305 | 36/18723 | 2.19e-03 | 9.95e-03 | 23 |
GO:00436166 | Oral cavity | OSCC | keratinocyte proliferation | 28/7305 | 46/18723 | 2.19e-03 | 9.95e-03 | 28 |
GO:00342495 | Oral cavity | OSCC | negative regulation of cellular amide metabolic process | 130/7305 | 273/18723 | 2.20e-03 | 1.00e-02 | 130 |
GO:00714723 | Oral cavity | OSCC | cellular response to salt stress | 10/7305 | 12/18723 | 2.25e-03 | 1.00e-02 | 10 |
GO:00219158 | Oral cavity | OSCC | neural tube development | 77/7305 | 152/18723 | 2.26e-03 | 1.00e-02 | 77 |
GO:00434916 | Oral cavity | OSCC | protein kinase B signaling | 103/7305 | 211/18723 | 2.29e-03 | 1.02e-02 | 103 |
GO:00454453 | Oral cavity | OSCC | myoblast differentiation | 46/7305 | 84/18723 | 2.43e-03 | 1.07e-02 | 46 |
GO:00456166 | Oral cavity | OSCC | regulation of keratinocyte differentiation | 23/7305 | 37/18723 | 3.66e-03 | 1.51e-02 | 23 |
GO:00027616 | Oral cavity | OSCC | regulation of myeloid leukocyte differentiation | 61/7305 | 120/18723 | 5.52e-03 | 2.14e-02 | 61 |
GO:00606699 | Oral cavity | OSCC | embryonic placenta morphogenesis | 17/7305 | 26/18723 | 5.83e-03 | 2.23e-02 | 17 |
GO:00082982 | Oral cavity | OSCC | intracellular mRNA localization | 10/7305 | 13/18723 | 6.32e-03 | 2.35e-02 | 10 |
GO:19021075 | Oral cavity | OSCC | positive regulation of leukocyte differentiation | 77/7305 | 157/18723 | 6.55e-03 | 2.43e-02 | 77 |
GO:19037085 | Oral cavity | OSCC | positive regulation of hemopoiesis | 77/7305 | 157/18723 | 6.55e-03 | 2.43e-02 | 77 |
GO:00703716 | Oral cavity | OSCC | ERK1 and ERK2 cascade | 150/7305 | 330/18723 | 9.47e-03 | 3.38e-02 | 150 |
GO:00352646 | Oral cavity | OSCC | multicellular organism growth | 65/7305 | 132/18723 | 1.06e-02 | 3.60e-02 | 65 |
GO:00456194 | Oral cavity | OSCC | regulation of lymphocyte differentiation | 83/7305 | 174/18723 | 1.18e-02 | 4.00e-02 | 83 |
GO:00713848 | Oral cavity | OSCC | cellular response to corticosteroid stimulus | 33/7305 | 61/18723 | 1.19e-02 | 4.02e-02 | 33 |
GO:00171485 | Oral cavity | OSCC | negative regulation of translation | 113/7305 | 245/18723 | 1.34e-02 | 4.45e-02 | 113 |
GO:000640319 | Oral cavity | LP | RNA localization | 105/4623 | 201/18723 | 3.34e-17 | 5.36e-15 | 105 |
GO:005068418 | Oral cavity | LP | regulation of mRNA processing | 76/4623 | 137/18723 | 1.14e-14 | 1.35e-12 | 76 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ZFP36L1 | SNV | Missense_Mutation | novel | c.506N>C | p.Tyr169Ser | p.Y169S | Q07352 | protein_coding | deleterious(0.01) | probably_damaging(0.998) | TCGA-A8-A07F-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | tamoxiphen | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.34N>A | p.Asp12Asn | p.D12N | Q07352 | protein_coding | deleterious(0) | benign(0.114) | TCGA-B6-A0RS-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
ZFP36L1 | deletion | In_Frame_Del | | c.526_528delNNN | p.Ile176del | p.I176del | Q07352 | protein_coding | | | TCGA-A2-A0T4-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | femara | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.125_126insG | p.Thr43HisfsTer32 | p.T43Hfs*32 | Q07352 | protein_coding | | | TCGA-AN-A03X-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.907_908insG | p.Glu303GlyfsTer36 | p.E303Gfs*36 | Q07352 | protein_coding | | | TCGA-AN-A0AM-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | deletion | Frame_Shift_Del | | c.943_989delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | p.Gly315GlnfsTer8 | p.G315Qfs*8 | Q07352 | protein_coding | | | TCGA-AN-A0FJ-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.677_678insAGCCCCACGTCCAT | p.Thr227AlafsTer11 | p.T227Afs*11 | Q07352 | protein_coding | | | TCGA-BH-A0B0-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | CR |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.98_99insG | p.Cys34LeufsTer41 | p.C34Lfs*41 | Q07352 | protein_coding | | | TCGA-GM-A2DC-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | xeloda | CR |
ZFP36L1 | deletion | Frame_Shift_Del | novel | c.345_375delCAAGACGGAGCTGTGCCGCCCCTTTGAGGAA | p.Tyr115Ter | p.Y115* | Q07352 | protein_coding | | | TCGA-LD-A7W6-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | letrozole | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.476N>A | p.Arg159His | p.R159H | Q07352 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-2W-A8YY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |