Tissue | Expression Dynamics | Abbreviation |
Breast | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Breast/ZFP36L1_pca_on_diff_genes.png) | IDC: Invasive ductal carcinoma |
DCIS: Ductal carcinoma in situ |
Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers |
Cervix | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Cervix/ZFP36L1_pca_on_diff_genes.png) | CC: Cervix cancer |
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions |
N_HPV: HPV-infected normal cervix |
Colorectum (GSE201348) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Becker/ZFP36L1_pca_on_diff_genes.png) | FAP: Familial adenomatous polyposis |
CRC: Colorectal cancer |
Colorectum (HTA11) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Chen/ZFP36L1_pca_on_diff_genes.png) | AD: Adenomas |
SER: Sessile serrated lesions |
MSI-H: Microsatellite-high colorectal cancer |
MSS: Microsatellite stable colorectal cancer |
Endometrium | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Endometrium/ZFP36L1_pca_on_diff_genes.png) | AEH: Atypical endometrial hyperplasia |
EEC: Endometrioid Cancer |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/ZFP36L1_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Liver/ZFP36L1_pca_on_diff_genes.png) | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Lung | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Lung/ZFP36L1_pca_on_diff_genes.png) | AAH: Atypical adenomatous hyperplasia |
AIS: Adenocarcinoma in situ |
IAC: Invasive lung adenocarcinoma |
MIA: Minimally invasive adenocarcinoma |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/ZFP36L1_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Prostate | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Prostate/ZFP36L1_pca_on_diff_genes.png) | BPH: Benign Prostatic Hyperplasia |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/ZFP36L1_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/ZFP36L1_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:190331312 | Lung | AIS | positive regulation of mRNA metabolic process | 25/1849 | 118/18723 | 1.85e-04 | 3.83e-03 | 25 |
GO:003629412 | Lung | AIS | cellular response to decreased oxygen levels | 31/1849 | 161/18723 | 2.15e-04 | 4.36e-03 | 31 |
GO:003085611 | Lung | AIS | regulation of epithelial cell differentiation | 30/1849 | 154/18723 | 2.18e-04 | 4.41e-03 | 30 |
GO:005159113 | Lung | AIS | response to cAMP | 21/1849 | 93/18723 | 2.35e-04 | 4.68e-03 | 21 |
GO:007145312 | Lung | AIS | cellular response to oxygen levels | 33/1849 | 177/18723 | 2.56e-04 | 4.96e-03 | 33 |
GO:000166613 | Lung | AIS | response to hypoxia | 50/1849 | 307/18723 | 2.79e-04 | 5.26e-03 | 50 |
GO:004348812 | Lung | AIS | regulation of mRNA stability | 30/1849 | 158/18723 | 3.46e-04 | 6.25e-03 | 30 |
GO:007145612 | Lung | AIS | cellular response to hypoxia | 29/1849 | 151/18723 | 3.54e-04 | 6.32e-03 | 29 |
GO:006101312 | Lung | AIS | regulation of mRNA catabolic process | 31/1849 | 166/18723 | 3.77e-04 | 6.61e-03 | 31 |
GO:007132011 | Lung | AIS | cellular response to cAMP | 14/1849 | 53/18723 | 4.73e-04 | 7.84e-03 | 14 |
GO:0070371 | Lung | AIS | ERK1 and ERK2 cascade | 52/1849 | 330/18723 | 4.80e-04 | 7.95e-03 | 52 |
GO:006048511 | Lung | AIS | mesenchyme development | 47/1849 | 291/18723 | 5.06e-04 | 8.28e-03 | 47 |
GO:007048213 | Lung | AIS | response to oxygen levels | 54/1849 | 347/18723 | 5.15e-04 | 8.38e-03 | 54 |
GO:004348712 | Lung | AIS | regulation of RNA stability | 31/1849 | 170/18723 | 5.76e-04 | 8.97e-03 | 31 |
GO:006101412 | Lung | AIS | positive regulation of mRNA catabolic process | 19/1849 | 87/18723 | 7.09e-04 | 1.04e-02 | 19 |
GO:003806611 | Lung | AIS | p38MAPK cascade | 14/1849 | 55/18723 | 7.09e-04 | 1.04e-02 | 14 |
GO:002191511 | Lung | AIS | neural tube development | 28/1849 | 152/18723 | 8.81e-04 | 1.19e-02 | 28 |
GO:000189212 | Lung | AIS | embryonic placenta development | 18/1849 | 82/18723 | 9.09e-04 | 1.21e-02 | 18 |
GO:007121412 | Lung | AIS | cellular response to abiotic stimulus | 51/1849 | 331/18723 | 9.10e-04 | 1.21e-02 | 51 |
GO:010400412 | Lung | AIS | cellular response to environmental stimulus | 51/1849 | 331/18723 | 9.10e-04 | 1.21e-02 | 51 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ZFP36L1 | SNV | Missense_Mutation | novel | c.506N>C | p.Tyr169Ser | p.Y169S | Q07352 | protein_coding | deleterious(0.01) | probably_damaging(0.998) | TCGA-A8-A07F-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | tamoxiphen | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.34N>A | p.Asp12Asn | p.D12N | Q07352 | protein_coding | deleterious(0) | benign(0.114) | TCGA-B6-A0RS-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
ZFP36L1 | deletion | In_Frame_Del | | c.526_528delNNN | p.Ile176del | p.I176del | Q07352 | protein_coding | | | TCGA-A2-A0T4-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | femara | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.125_126insG | p.Thr43HisfsTer32 | p.T43Hfs*32 | Q07352 | protein_coding | | | TCGA-AN-A03X-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.907_908insG | p.Glu303GlyfsTer36 | p.E303Gfs*36 | Q07352 | protein_coding | | | TCGA-AN-A0AM-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | deletion | Frame_Shift_Del | | c.943_989delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | p.Gly315GlnfsTer8 | p.G315Qfs*8 | Q07352 | protein_coding | | | TCGA-AN-A0FJ-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.677_678insAGCCCCACGTCCAT | p.Thr227AlafsTer11 | p.T227Afs*11 | Q07352 | protein_coding | | | TCGA-BH-A0B0-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | CR |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.98_99insG | p.Cys34LeufsTer41 | p.C34Lfs*41 | Q07352 | protein_coding | | | TCGA-GM-A2DC-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | xeloda | CR |
ZFP36L1 | deletion | Frame_Shift_Del | novel | c.345_375delCAAGACGGAGCTGTGCCGCCCCTTTGAGGAA | p.Tyr115Ter | p.Y115* | Q07352 | protein_coding | | | TCGA-LD-A7W6-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | letrozole | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.476N>A | p.Arg159His | p.R159H | Q07352 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-2W-A8YY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |