Tissue | Expression Dynamics | Abbreviation |
Colorectum (GSE201348) | | FAP: Familial adenomatous polyposis |
CRC: Colorectal cancer |
Colorectum (HTA11) | | AD: Adenomas |
SER: Sessile serrated lesions |
MSI-H: Microsatellite-high colorectal cancer |
MSS: Microsatellite stable colorectal cancer |
Esophagus | | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Oral Cavity | | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Skin | | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00165756 | Thyroid | PTC | histone deacetylation | 45/5968 | 82/18723 | 1.34e-05 | 1.45e-04 | 45 |
GO:00064767 | Thyroid | PTC | protein deacetylation | 53/5968 | 101/18723 | 1.36e-05 | 1.47e-04 | 53 |
GO:00987327 | Thyroid | PTC | macromolecule deacylation | 58/5968 | 116/18723 | 3.59e-05 | 3.36e-04 | 58 |
GO:00328866 | Thyroid | PTC | regulation of microtubule-based process | 105/5968 | 240/18723 | 6.91e-05 | 6.03e-04 | 105 |
GO:000283114 | Thyroid | PTC | regulation of response to biotic stimulus | 136/5968 | 327/18723 | 1.22e-04 | 9.69e-04 | 136 |
GO:00109486 | Thyroid | PTC | negative regulation of cell cycle process | 122/5968 | 294/18723 | 2.94e-04 | 2.08e-03 | 122 |
GO:005149419 | Thyroid | PTC | negative regulation of cytoskeleton organization | 73/5968 | 163/18723 | 3.59e-04 | 2.44e-03 | 73 |
GO:00310235 | Thyroid | PTC | microtubule organizing center organization | 65/5968 | 143/18723 | 4.48e-04 | 2.96e-03 | 65 |
GO:003210316 | Thyroid | PTC | positive regulation of response to external stimulus | 167/5968 | 427/18723 | 8.31e-04 | 5.13e-03 | 167 |
GO:00022186 | Thyroid | PTC | activation of innate immune response | 28/5968 | 52/18723 | 8.33e-04 | 5.13e-03 | 28 |
GO:00070984 | Thyroid | PTC | centrosome cycle | 59/5968 | 130/18723 | 8.39e-04 | 5.16e-03 | 59 |
GO:0051298 | Thyroid | PTC | centrosome duplication | 36/5968 | 73/18723 | 1.41e-03 | 7.89e-03 | 36 |
GO:00108244 | Thyroid | PTC | regulation of centrosome duplication | 24/5968 | 45/18723 | 2.28e-03 | 1.20e-02 | 24 |
GO:00450887 | Thyroid | PTC | regulation of innate immune response | 89/5968 | 218/18723 | 3.16e-03 | 1.55e-02 | 89 |
GO:00466055 | Thyroid | PTC | regulation of centrosome cycle | 25/5968 | 49/18723 | 4.09e-03 | 1.95e-02 | 25 |
GO:000838034 | Thyroid | ATC | RNA splicing | 270/6293 | 434/18723 | 7.50e-35 | 1.19e-31 | 270 |
GO:000037534 | Thyroid | ATC | RNA splicing, via transesterification reactions | 200/6293 | 324/18723 | 1.75e-25 | 7.39e-23 | 200 |
GO:000037734 | Thyroid | ATC | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 197/6293 | 320/18723 | 6.54e-25 | 2.18e-22 | 197 |
GO:000039834 | Thyroid | ATC | mRNA splicing, via spliceosome | 197/6293 | 320/18723 | 6.54e-25 | 2.18e-22 | 197 |
GO:001657017 | Thyroid | ATC | histone modification | 243/6293 | 463/18723 | 2.23e-17 | 2.27e-15 | 243 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
RBM14 | SNV | Missense_Mutation | | c.545N>G | p.Ser182Cys | p.S182C | Q96PK6 | protein_coding | deleterious(0.01) | probably_damaging(0.925) | TCGA-A8-A095-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | 5-fluorouracil | CR |
RBM14 | SNV | Missense_Mutation | | c.674N>G | p.Ser225Cys | p.S225C | Q96PK6 | protein_coding | deleterious_low_confidence(0) | possibly_damaging(0.89) | TCGA-A8-A095-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | 5-fluorouracil | CR |
RBM14 | SNV | Missense_Mutation | | c.1754N>A | p.Arg585Gln | p.R585Q | Q96PK6 | protein_coding | tolerated(0.1) | benign(0.003) | TCGA-AR-A24V-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | SD |
RBM14 | SNV | Missense_Mutation | rs764529837 | c.1220N>T | p.Ser407Leu | p.S407L | Q96PK6 | protein_coding | deleterious(0.01) | benign(0.019) | TCGA-D8-A27G-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
RBM14 | SNV | Missense_Mutation | | c.592T>C | p.Phe198Leu | p.F198L | Q96PK6 | protein_coding | deleterious(0.01) | benign(0.001) | TCGA-E2-A14R-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | PD |
RBM14 | SNV | Missense_Mutation | rs773352601 | c.938C>T | p.Ser313Leu | p.S313L | Q96PK6 | protein_coding | tolerated(0.22) | possibly_damaging(0.885) | TCGA-C5-A7UH-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | SD |
RBM14 | SNV | Missense_Mutation | | c.1436C>T | p.Ser479Leu | p.S479L | Q96PK6 | protein_coding | deleterious(0.02) | benign(0.018) | TCGA-C5-A7UH-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | SD |
RBM14 | SNV | Missense_Mutation | novel | c.280N>A | p.Glu94Lys | p.E94K | Q96PK6 | protein_coding | deleterious(0.03) | probably_damaging(0.93) | TCGA-C5-A8XH-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD |
RBM14 | insertion | In_Frame_Ins | novel | c.414_434dupGGGCAAGCGCATCAACGTGGA | p.Gly139_Glu145dup | p.G139_E145dup | Q96PK6 | protein_coding | | | TCGA-Q1-A6DW-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | SD |
RBM14 | SNV | Missense_Mutation | rs751672990 | c.608N>A | p.Arg203His | p.R203H | Q96PK6 | protein_coding | deleterious(0) | benign(0.049) | TCGA-5M-AAT6-01 | Colorectum | colon adenocarcinoma | Female | <65 | III/IV | Unknown | Unknown | PD |