Tissue | Expression Dynamics | Abbreviation |
Colorectum (GSE201348) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Becker/RBM14_pca_on_diff_genes.png) | FAP: Familial adenomatous polyposis |
CRC: Colorectal cancer |
Colorectum (HTA11) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Chen/RBM14_pca_on_diff_genes.png) | AD: Adenomas |
SER: Sessile serrated lesions |
MSI-H: Microsatellite-high colorectal cancer |
MSS: Microsatellite stable colorectal cancer |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/RBM14_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/RBM14_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/RBM14_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/RBM14_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00064766 | Skin | cSCC | protein deacetylation | 45/4864 | 101/18723 | 3.97e-05 | 4.26e-04 | 45 |
GO:00987326 | Skin | cSCC | macromolecule deacylation | 50/4864 | 116/18723 | 4.47e-05 | 4.69e-04 | 50 |
GO:190211515 | Skin | cSCC | regulation of organelle assembly | 72/4864 | 186/18723 | 8.90e-05 | 8.35e-04 | 72 |
GO:00310234 | Skin | cSCC | microtubule organizing center organization | 58/4864 | 143/18723 | 9.47e-05 | 8.83e-04 | 58 |
GO:00070983 | Skin | cSCC | centrosome cycle | 53/4864 | 130/18723 | 1.59e-04 | 1.39e-03 | 53 |
GO:000283122 | Skin | cSCC | regulation of response to biotic stimulus | 112/4864 | 327/18723 | 5.00e-04 | 3.76e-03 | 112 |
GO:003288612 | Skin | cSCC | regulation of microtubule-based process | 82/4864 | 240/18723 | 2.82e-03 | 1.58e-02 | 82 |
GO:004508812 | Skin | cSCC | regulation of innate immune response | 75/4864 | 218/18723 | 3.40e-03 | 1.84e-02 | 75 |
GO:00108243 | Skin | cSCC | regulation of centrosome duplication | 20/4864 | 45/18723 | 5.54e-03 | 2.74e-02 | 20 |
GO:00466054 | Skin | cSCC | regulation of centrosome cycle | 21/4864 | 49/18723 | 7.52e-03 | 3.53e-02 | 21 |
GO:0008380113 | Thyroid | PTC | RNA splicing | 273/5968 | 434/18723 | 4.44e-41 | 1.40e-37 | 273 |
GO:0000375113 | Thyroid | PTC | RNA splicing, via transesterification reactions | 202/5968 | 324/18723 | 6.81e-30 | 3.91e-27 | 202 |
GO:0000377113 | Thyroid | PTC | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 199/5968 | 320/18723 | 2.96e-29 | 1.44e-26 | 199 |
GO:0000398113 | Thyroid | PTC | mRNA splicing, via spliceosome | 199/5968 | 320/18723 | 2.96e-29 | 1.44e-26 | 199 |
GO:001657010 | Thyroid | PTC | histone modification | 235/5968 | 463/18723 | 1.17e-17 | 1.15e-15 | 235 |
GO:0010639112 | Thyroid | PTC | negative regulation of organelle organization | 163/5968 | 348/18723 | 3.04e-09 | 8.39e-08 | 163 |
GO:000717819 | Thyroid | PTC | transmembrane receptor protein serine/threonine kinase signaling pathway | 156/5968 | 355/18723 | 1.02e-06 | 1.51e-05 | 156 |
GO:00457867 | Thyroid | PTC | negative regulation of cell cycle | 166/5968 | 385/18723 | 1.93e-06 | 2.64e-05 | 166 |
GO:190211516 | Thyroid | PTC | regulation of organelle assembly | 88/5968 | 186/18723 | 7.41e-06 | 8.65e-05 | 88 |
GO:00356017 | Thyroid | PTC | protein deacylation | 58/5968 | 112/18723 | 9.29e-06 | 1.05e-04 | 58 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
RBM14 | SNV | Missense_Mutation | | c.545N>G | p.Ser182Cys | p.S182C | Q96PK6 | protein_coding | deleterious(0.01) | probably_damaging(0.925) | TCGA-A8-A095-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | 5-fluorouracil | CR |
RBM14 | SNV | Missense_Mutation | | c.674N>G | p.Ser225Cys | p.S225C | Q96PK6 | protein_coding | deleterious_low_confidence(0) | possibly_damaging(0.89) | TCGA-A8-A095-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | 5-fluorouracil | CR |
RBM14 | SNV | Missense_Mutation | | c.1754N>A | p.Arg585Gln | p.R585Q | Q96PK6 | protein_coding | tolerated(0.1) | benign(0.003) | TCGA-AR-A24V-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | SD |
RBM14 | SNV | Missense_Mutation | rs764529837 | c.1220N>T | p.Ser407Leu | p.S407L | Q96PK6 | protein_coding | deleterious(0.01) | benign(0.019) | TCGA-D8-A27G-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
RBM14 | SNV | Missense_Mutation | | c.592T>C | p.Phe198Leu | p.F198L | Q96PK6 | protein_coding | deleterious(0.01) | benign(0.001) | TCGA-E2-A14R-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | PD |
RBM14 | SNV | Missense_Mutation | rs773352601 | c.938C>T | p.Ser313Leu | p.S313L | Q96PK6 | protein_coding | tolerated(0.22) | possibly_damaging(0.885) | TCGA-C5-A7UH-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | SD |
RBM14 | SNV | Missense_Mutation | | c.1436C>T | p.Ser479Leu | p.S479L | Q96PK6 | protein_coding | deleterious(0.02) | benign(0.018) | TCGA-C5-A7UH-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | SD |
RBM14 | SNV | Missense_Mutation | novel | c.280N>A | p.Glu94Lys | p.E94K | Q96PK6 | protein_coding | deleterious(0.03) | probably_damaging(0.93) | TCGA-C5-A8XH-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD |
RBM14 | insertion | In_Frame_Ins | novel | c.414_434dupGGGCAAGCGCATCAACGTGGA | p.Gly139_Glu145dup | p.G139_E145dup | Q96PK6 | protein_coding | | | TCGA-Q1-A6DW-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | SD |
RBM14 | SNV | Missense_Mutation | rs751672990 | c.608N>A | p.Arg203His | p.R203H | Q96PK6 | protein_coding | deleterious(0) | benign(0.049) | TCGA-5M-AAT6-01 | Colorectum | colon adenocarcinoma | Female | <65 | III/IV | Unknown | Unknown | PD |