Tissue | Expression Dynamics | Abbreviation |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/DLGAP5_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/DLGAP5_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/DLGAP5_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/DLGAP5_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:004477223 | Skin | cSCC | mitotic cell cycle phase transition | 180/4864 | 424/18723 | 7.09e-14 | 4.45e-12 | 180 |
GO:00482854 | Skin | cSCC | organelle fission | 197/4864 | 488/18723 | 1.51e-12 | 8.36e-11 | 197 |
GO:009881311 | Skin | cSCC | nuclear chromosome segregation | 126/4864 | 281/18723 | 4.76e-12 | 2.53e-10 | 126 |
GO:00002803 | Skin | cSCC | nuclear division | 178/4864 | 439/18723 | 1.17e-11 | 5.93e-10 | 178 |
GO:005000012 | Skin | cSCC | chromosome localization | 50/4864 | 82/18723 | 2.41e-11 | 1.19e-09 | 50 |
GO:00513034 | Skin | cSCC | establishment of chromosome localization | 49/4864 | 80/18723 | 3.02e-11 | 1.48e-09 | 49 |
GO:190199014 | Skin | cSCC | regulation of mitotic cell cycle phase transition | 128/4864 | 299/18723 | 1.48e-10 | 6.56e-09 | 128 |
GO:00519834 | Skin | cSCC | regulation of chromosome segregation | 52/4864 | 91/18723 | 2.88e-10 | 1.20e-08 | 52 |
GO:006184215 | Skin | cSCC | microtubule organizing center localization | 25/4864 | 33/18723 | 3.13e-09 | 1.08e-07 | 25 |
GO:005164214 | Skin | cSCC | centrosome localization | 24/4864 | 32/18723 | 9.21e-09 | 2.87e-07 | 24 |
GO:00070913 | Skin | cSCC | metaphase/anaphase transition of mitotic cell cycle | 37/4864 | 62/18723 | 2.13e-08 | 6.11e-07 | 37 |
GO:00330453 | Skin | cSCC | regulation of sister chromatid segregation | 41/4864 | 72/18723 | 2.48e-08 | 6.89e-07 | 41 |
GO:19058183 | Skin | cSCC | regulation of chromosome separation | 41/4864 | 72/18723 | 2.48e-08 | 6.89e-07 | 41 |
GO:00300713 | Skin | cSCC | regulation of mitotic metaphase/anaphase transition | 36/4864 | 60/18723 | 2.71e-08 | 7.41e-07 | 36 |
GO:00109653 | Skin | cSCC | regulation of mitotic sister chromatid separation | 38/4864 | 65/18723 | 3.03e-08 | 8.18e-07 | 38 |
GO:190198714 | Skin | cSCC | regulation of cell cycle phase transition | 150/4864 | 390/18723 | 3.21e-08 | 8.61e-07 | 150 |
GO:00070884 | Skin | cSCC | regulation of mitotic nuclear division | 55/4864 | 110/18723 | 5.62e-08 | 1.44e-06 | 55 |
GO:00513063 | Skin | cSCC | mitotic sister chromatid separation | 38/4864 | 67/18723 | 9.27e-08 | 2.22e-06 | 38 |
GO:00447843 | Skin | cSCC | metaphase/anaphase transition of cell cycle | 37/4864 | 65/18723 | 1.20e-07 | 2.79e-06 | 37 |
GO:19020993 | Skin | cSCC | regulation of metaphase/anaphase transition of cell cycle | 36/4864 | 63/18723 | 1.55e-07 | 3.51e-06 | 36 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
DLGAP5 | SNV | Missense_Mutation | novel | c.1922N>C | p.Lys641Thr | p.K641T | Q15398 | protein_coding | tolerated(0.2) | benign(0.003) | TCGA-AN-A046-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
DLGAP5 | SNV | Missense_Mutation | | c.992N>A | p.Arg331Lys | p.R331K | Q15398 | protein_coding | tolerated(0.07) | benign(0.151) | TCGA-D8-A1JA-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | adriamycin | PD |
DLGAP5 | SNV | Missense_Mutation | | c.1978N>G | p.Thr660Ala | p.T660A | Q15398 | protein_coding | tolerated(0.61) | benign(0.007) | TCGA-E2-A1LL-01 | Breast | breast invasive carcinoma | Female | >=65 | III/IV | Chemotherapy | docetaxel | PD |
DLGAP5 | deletion | Frame_Shift_Del | | c.124_160delAATAGACACTTTGGTTTGAAAGATGTAAACATTCCAA | p.Asn42ProfsTer10 | p.N42Pfs*10 | Q15398 | protein_coding | | | TCGA-A1-A0SO-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | | SD |
DLGAP5 | deletion | Frame_Shift_Del | novel | c.1773delN | p.Glu591AspfsTer9 | p.E591Dfs*9 | Q15398 | protein_coding | | | TCGA-EW-A2FV-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | docetaxel | SD |
DLGAP5 | deletion | Frame_Shift_Del | novel | c.1519delN | p.Asp507MetfsTer11 | p.D507Mfs*11 | Q15398 | protein_coding | | | TCGA-EW-A2FV-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | docetaxel | SD |
DLGAP5 | SNV | Missense_Mutation | | c.326N>G | p.Gln109Arg | p.Q109R | Q15398 | protein_coding | deleterious(0) | probably_damaging(0.909) | TCGA-C5-A3HL-01 | Cervix | cervical & endocervical cancer | Female | >=65 | I/II | Unknown | Unknown | SD |
DLGAP5 | SNV | Missense_Mutation | | c.1045N>A | p.Glu349Lys | p.E349K | Q15398 | protein_coding | tolerated(0.1) | benign(0.173) | TCGA-LP-A4AV-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD |
DLGAP5 | SNV | Missense_Mutation | novel | c.673N>T | p.Ala225Ser | p.A225S | Q15398 | protein_coding | tolerated(0.28) | benign(0.003) | TCGA-MA-AA3W-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
DLGAP5 | SNV | Missense_Mutation | novel | c.322G>C | p.Glu108Gln | p.E108Q | Q15398 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-VS-A9UZ-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD |