Tissue | Expression Dynamics | Abbreviation |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/TBRG4_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Liver/TBRG4_pca_on_diff_genes.png) | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/TBRG4_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/TBRG4_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/TBRG4_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:0034655112 | Thyroid | PTC | nucleobase-containing compound catabolic process | 211/5968 | 407/18723 | 2.72e-17 | 2.52e-15 | 211 |
GO:0046700111 | Thyroid | PTC | heterocycle catabolic process | 221/5968 | 445/18723 | 2.43e-15 | 1.72e-13 | 221 |
GO:0044270111 | Thyroid | PTC | cellular nitrogen compound catabolic process | 223/5968 | 451/18723 | 3.34e-15 | 2.31e-13 | 223 |
GO:0019439111 | Thyroid | PTC | aromatic compound catabolic process | 225/5968 | 467/18723 | 8.51e-14 | 4.71e-12 | 225 |
GO:1901361111 | Thyroid | PTC | organic cyclic compound catabolic process | 231/5968 | 495/18723 | 2.55e-12 | 1.12e-10 | 231 |
GO:0043487111 | Thyroid | PTC | regulation of RNA stability | 97/5968 | 170/18723 | 9.51e-12 | 3.97e-10 | 97 |
GO:0061013111 | Thyroid | PTC | regulation of mRNA catabolic process | 94/5968 | 166/18723 | 3.55e-11 | 1.29e-09 | 94 |
GO:0043488111 | Thyroid | PTC | regulation of mRNA stability | 90/5968 | 158/18723 | 5.98e-11 | 2.11e-09 | 90 |
GO:01400536 | Thyroid | PTC | mitochondrial gene expression | 51/5968 | 108/18723 | 6.04e-04 | 3.83e-03 | 51 |
GO:190331134 | Thyroid | ATC | regulation of mRNA metabolic process | 181/6293 | 288/18723 | 1.75e-24 | 5.54e-22 | 181 |
GO:000640127 | Thyroid | ATC | RNA catabolic process | 165/6293 | 278/18723 | 8.45e-19 | 1.14e-16 | 165 |
GO:000640227 | Thyroid | ATC | mRNA catabolic process | 140/6293 | 232/18723 | 5.08e-17 | 4.65e-15 | 140 |
GO:003465525 | Thyroid | ATC | nucleobase-containing compound catabolic process | 217/6293 | 407/18723 | 1.20e-16 | 1.04e-14 | 217 |
GO:004670024 | Thyroid | ATC | heterocycle catabolic process | 228/6293 | 445/18723 | 7.26e-15 | 4.50e-13 | 228 |
GO:004427025 | Thyroid | ATC | cellular nitrogen compound catabolic process | 229/6293 | 451/18723 | 2.25e-14 | 1.27e-12 | 229 |
GO:001943924 | Thyroid | ATC | aromatic compound catabolic process | 232/6293 | 467/18723 | 3.05e-13 | 1.44e-11 | 232 |
GO:190136124 | Thyroid | ATC | organic cyclic compound catabolic process | 238/6293 | 495/18723 | 1.12e-11 | 4.12e-10 | 238 |
GO:004348725 | Thyroid | ATC | regulation of RNA stability | 97/6293 | 170/18723 | 2.68e-10 | 7.70e-09 | 97 |
GO:006101325 | Thyroid | ATC | regulation of mRNA catabolic process | 95/6293 | 166/18723 | 3.27e-10 | 9.16e-09 | 95 |
GO:004348826 | Thyroid | ATC | regulation of mRNA stability | 90/6293 | 158/18723 | 1.31e-09 | 3.30e-08 | 90 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
TBRG4 | SNV | Missense_Mutation | novel | c.1607N>A | p.Pro536His | p.P536H | Q969Z0 | protein_coding | deleterious(0.01) | probably_damaging(0.915) | TCGA-AR-A2LN-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | letrozole | SD |
TBRG4 | SNV | Missense_Mutation | novel | c.533N>G | p.Lys178Arg | p.K178R | Q969Z0 | protein_coding | tolerated(1) | benign(0.001) | TCGA-BH-A42T-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
TBRG4 | SNV | Missense_Mutation | rs143689271 | c.811C>T | p.Arg271Trp | p.R271W | Q969Z0 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-D8-A1J8-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | nolvadex | SD |
TBRG4 | insertion | In_Frame_Ins | novel | c.68_69insCAC | p.Met23delinsIleThr | p.M23delinsIT | Q969Z0 | protein_coding | | | TCGA-AR-A0TY-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unspecific | Paclitaxel | PD |
TBRG4 | insertion | Frame_Shift_Ins | novel | c.67_68insGAATTCA | p.Met23ArgfsTer17 | p.M23Rfs*17 | Q969Z0 | protein_coding | | | TCGA-AR-A0TY-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unspecific | Paclitaxel | PD |
TBRG4 | insertion | In_Frame_Ins | novel | c.1570_1571insGTC | p.Ala524delinsGlyPro | p.A524delinsGP | Q969Z0 | protein_coding | | | TCGA-B6-A0IN-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
TBRG4 | insertion | Nonsense_Mutation | novel | c.1568_1569insGGCTTCCTGATAGTGGACGTGAGTACCTCTTGGGCAGG | p.Asp523GlufsTer4 | p.D523Efs*4 | Q969Z0 | protein_coding | | | TCGA-B6-A0IN-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
TBRG4 | deletion | In_Frame_Del | | c.606_659delGCTGCTGGCTGAGCTGCTCACACACCTGGAAAGGCGTTGGACAGAAATTGAAGA | p.Glu202_Glu219del | p.E202_E219del | Q969Z0 | protein_coding | | | TCGA-E2-A1LH-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | SD |
TBRG4 | SNV | Missense_Mutation | novel | c.337G>C | p.Glu113Gln | p.E113Q | Q969Z0 | protein_coding | tolerated(0.16) | benign(0.08) | TCGA-HM-A4S6-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | CR |
TBRG4 | SNV | Missense_Mutation | | c.776N>A | p.Arg259Gln | p.R259Q | Q969Z0 | protein_coding | tolerated(0.05) | probably_damaging(0.974) | TCGA-A6-3809-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |