Tissue | Expression Dynamics | Abbreviation |
Breast | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Breast/ZFP36L1_pca_on_diff_genes.png) | IDC: Invasive ductal carcinoma |
DCIS: Ductal carcinoma in situ |
Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers |
Cervix | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Cervix/ZFP36L1_pca_on_diff_genes.png) | CC: Cervix cancer |
HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions |
N_HPV: HPV-infected normal cervix |
Colorectum (GSE201348) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Becker/ZFP36L1_pca_on_diff_genes.png) | FAP: Familial adenomatous polyposis |
CRC: Colorectal cancer |
Colorectum (HTA11) | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Colorectum/Chen/ZFP36L1_pca_on_diff_genes.png) | AD: Adenomas |
SER: Sessile serrated lesions |
MSI-H: Microsatellite-high colorectal cancer |
MSS: Microsatellite stable colorectal cancer |
Endometrium | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Endometrium/ZFP36L1_pca_on_diff_genes.png) | AEH: Atypical endometrial hyperplasia |
EEC: Endometrioid Cancer |
Esophagus | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Esophagus/ZFP36L1_pca_on_diff_genes.png) | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Liver/ZFP36L1_pca_on_diff_genes.png) | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Lung | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Lung/ZFP36L1_pca_on_diff_genes.png) | AAH: Atypical adenomatous hyperplasia |
AIS: Adenocarcinoma in situ |
IAC: Invasive lung adenocarcinoma |
MIA: Minimally invasive adenocarcinoma |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/ZFP36L1_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Prostate | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Prostate/ZFP36L1_pca_on_diff_genes.png) | BPH: Benign Prostatic Hyperplasia |
Skin | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Skin/ZFP36L1_pca_on_diff_genes.png) | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/ZFP36L1_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:007135610 | Endometrium | AEH | cellular response to tumor necrosis factor | 41/2100 | 229/18723 | 1.66e-03 | 1.36e-02 | 41 |
GO:003009916 | Endometrium | AEH | myeloid cell differentiation | 62/2100 | 381/18723 | 1.67e-03 | 1.36e-02 | 62 |
GO:00456823 | Endometrium | AEH | regulation of epidermis development | 16/2100 | 65/18723 | 1.81e-03 | 1.44e-02 | 16 |
GO:00712149 | Endometrium | AEH | cellular response to abiotic stimulus | 55/2100 | 331/18723 | 1.85e-03 | 1.46e-02 | 55 |
GO:01040049 | Endometrium | AEH | cellular response to environmental stimulus | 55/2100 | 331/18723 | 1.85e-03 | 1.46e-02 | 55 |
GO:00328699 | Endometrium | AEH | cellular response to insulin stimulus | 37/2100 | 203/18723 | 1.97e-03 | 1.54e-02 | 37 |
GO:00611577 | Endometrium | AEH | mRNA destabilization | 19/2100 | 84/18723 | 2.07e-03 | 1.61e-02 | 19 |
GO:003461210 | Endometrium | AEH | response to tumor necrosis factor | 44/2100 | 253/18723 | 2.08e-03 | 1.61e-02 | 44 |
GO:00713758 | Endometrium | AEH | cellular response to peptide hormone stimulus | 49/2100 | 290/18723 | 2.24e-03 | 1.72e-02 | 49 |
GO:007145310 | Endometrium | AEH | cellular response to oxygen levels | 33/2100 | 177/18723 | 2.30e-03 | 1.74e-02 | 33 |
GO:00708499 | Endometrium | AEH | response to epidermal growth factor | 13/2100 | 49/18723 | 2.31e-03 | 1.74e-02 | 13 |
GO:00447726 | Endometrium | AEH | mitotic cell cycle phase transition | 67/2100 | 424/18723 | 2.37e-03 | 1.78e-02 | 67 |
GO:00435885 | Endometrium | AEH | skin development | 45/2100 | 263/18723 | 2.58e-03 | 1.90e-02 | 45 |
GO:00713649 | Endometrium | AEH | cellular response to epidermal growth factor stimulus | 12/2100 | 45/18723 | 3.21e-03 | 2.26e-02 | 12 |
GO:00507797 | Endometrium | AEH | RNA destabilization | 19/2100 | 88/18723 | 3.61e-03 | 2.48e-02 | 19 |
GO:19040195 | Endometrium | AEH | epithelial cell apoptotic process | 24/2100 | 121/18723 | 3.81e-03 | 2.60e-02 | 24 |
GO:00434914 | Endometrium | AEH | protein kinase B signaling | 37/2100 | 211/18723 | 3.89e-03 | 2.64e-02 | 37 |
GO:00456043 | Endometrium | AEH | regulation of epidermal cell differentiation | 14/2100 | 58/18723 | 4.12e-03 | 2.73e-02 | 14 |
GO:00456398 | Endometrium | AEH | positive regulation of myeloid cell differentiation | 21/2100 | 103/18723 | 4.69e-03 | 2.99e-02 | 21 |
GO:00328689 | Endometrium | AEH | response to insulin | 44/2100 | 264/18723 | 4.70e-03 | 3.00e-02 | 44 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ZFP36L1 | SNV | Missense_Mutation | novel | c.506N>C | p.Tyr169Ser | p.Y169S | Q07352 | protein_coding | deleterious(0.01) | probably_damaging(0.998) | TCGA-A8-A07F-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | tamoxiphen | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.34N>A | p.Asp12Asn | p.D12N | Q07352 | protein_coding | deleterious(0) | benign(0.114) | TCGA-B6-A0RS-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
ZFP36L1 | deletion | In_Frame_Del | | c.526_528delNNN | p.Ile176del | p.I176del | Q07352 | protein_coding | | | TCGA-A2-A0T4-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | femara | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.125_126insG | p.Thr43HisfsTer32 | p.T43Hfs*32 | Q07352 | protein_coding | | | TCGA-AN-A03X-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.907_908insG | p.Glu303GlyfsTer36 | p.E303Gfs*36 | Q07352 | protein_coding | | | TCGA-AN-A0AM-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
ZFP36L1 | deletion | Frame_Shift_Del | | c.943_989delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | p.Gly315GlnfsTer8 | p.G315Qfs*8 | Q07352 | protein_coding | | | TCGA-AN-A0FJ-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.677_678insAGCCCCACGTCCAT | p.Thr227AlafsTer11 | p.T227Afs*11 | Q07352 | protein_coding | | | TCGA-BH-A0B0-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | CR |
ZFP36L1 | insertion | Frame_Shift_Ins | novel | c.98_99insG | p.Cys34LeufsTer41 | p.C34Lfs*41 | Q07352 | protein_coding | | | TCGA-GM-A2DC-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | xeloda | CR |
ZFP36L1 | deletion | Frame_Shift_Del | novel | c.345_375delCAAGACGGAGCTGTGCCGCCCCTTTGAGGAA | p.Tyr115Ter | p.Y115* | Q07352 | protein_coding | | | TCGA-LD-A7W6-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | letrozole | SD |
ZFP36L1 | SNV | Missense_Mutation | novel | c.476N>A | p.Arg159His | p.R159H | Q07352 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-2W-A8YY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |