Tissue | Expression Dynamics | Abbreviation |
Esophagus | | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Oral Cavity | | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Skin | | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:000640118 | Oral cavity | OSCC | RNA catabolic process | 184/7305 | 278/18723 | 2.71e-20 | 4.19e-18 | 184 |
GO:000640218 | Oral cavity | OSCC | mRNA catabolic process | 156/7305 | 232/18723 | 2.13e-18 | 2.37e-16 | 156 |
GO:003465517 | Oral cavity | OSCC | nucleobase-containing compound catabolic process | 244/7305 | 407/18723 | 5.38e-18 | 5.49e-16 | 244 |
GO:004670015 | Oral cavity | OSCC | heterocycle catabolic process | 254/7305 | 445/18723 | 5.07e-15 | 3.31e-13 | 254 |
GO:004427016 | Oral cavity | OSCC | cellular nitrogen compound catabolic process | 256/7305 | 451/18723 | 9.67e-15 | 5.88e-13 | 256 |
GO:001943915 | Oral cavity | OSCC | aromatic compound catabolic process | 263/7305 | 467/18723 | 1.49e-14 | 8.84e-13 | 263 |
GO:190136115 | Oral cavity | OSCC | organic cyclic compound catabolic process | 272/7305 | 495/18723 | 2.73e-13 | 1.36e-11 | 272 |
GO:01400533 | Oral cavity | OSCC | mitochondrial gene expression | 78/7305 | 108/18723 | 2.37e-12 | 9.86e-11 | 78 |
GO:006101316 | Oral cavity | OSCC | regulation of mRNA catabolic process | 105/7305 | 166/18723 | 2.04e-10 | 5.82e-09 | 105 |
GO:004348716 | Oral cavity | OSCC | regulation of RNA stability | 106/7305 | 170/18723 | 5.65e-10 | 1.47e-08 | 106 |
GO:004348816 | Oral cavity | OSCC | regulation of mRNA stability | 99/7305 | 158/18723 | 1.41e-09 | 3.39e-08 | 99 |
GO:00009591 | Oral cavity | OSCC | mitochondrial RNA metabolic process | 29/7305 | 49/18723 | 3.33e-03 | 1.42e-02 | 29 |
GO:0000963 | Oral cavity | OSCC | mitochondrial RNA processing | 14/7305 | 20/18723 | 4.95e-03 | 1.94e-02 | 14 |
GO:190331119 | Oral cavity | LP | regulation of mRNA metabolic process | 129/4623 | 288/18723 | 5.70e-14 | 6.10e-12 | 129 |
GO:003465518 | Oral cavity | LP | nucleobase-containing compound catabolic process | 161/4623 | 407/18723 | 1.61e-11 | 1.15e-09 | 161 |
GO:000640119 | Oral cavity | LP | RNA catabolic process | 118/4623 | 278/18723 | 4.98e-11 | 3.12e-09 | 118 |
GO:001943916 | Oral cavity | LP | aromatic compound catabolic process | 176/4623 | 467/18723 | 1.96e-10 | 1.08e-08 | 176 |
GO:004427017 | Oral cavity | LP | cellular nitrogen compound catabolic process | 170/4623 | 451/18723 | 3.93e-10 | 2.02e-08 | 170 |
GO:004670016 | Oral cavity | LP | heterocycle catabolic process | 168/4623 | 445/18723 | 4.35e-10 | 2.20e-08 | 168 |
GO:190136116 | Oral cavity | LP | organic cyclic compound catabolic process | 180/4623 | 495/18723 | 3.11e-09 | 1.35e-07 | 180 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
TBRG4 | SNV | Missense_Mutation | novel | c.1607N>A | p.Pro536His | p.P536H | Q969Z0 | protein_coding | deleterious(0.01) | probably_damaging(0.915) | TCGA-AR-A2LN-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | letrozole | SD |
TBRG4 | SNV | Missense_Mutation | novel | c.533N>G | p.Lys178Arg | p.K178R | Q969Z0 | protein_coding | tolerated(1) | benign(0.001) | TCGA-BH-A42T-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
TBRG4 | SNV | Missense_Mutation | rs143689271 | c.811C>T | p.Arg271Trp | p.R271W | Q969Z0 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-D8-A1J8-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | nolvadex | SD |
TBRG4 | insertion | In_Frame_Ins | novel | c.68_69insCAC | p.Met23delinsIleThr | p.M23delinsIT | Q969Z0 | protein_coding | | | TCGA-AR-A0TY-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unspecific | Paclitaxel | PD |
TBRG4 | insertion | Frame_Shift_Ins | novel | c.67_68insGAATTCA | p.Met23ArgfsTer17 | p.M23Rfs*17 | Q969Z0 | protein_coding | | | TCGA-AR-A0TY-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unspecific | Paclitaxel | PD |
TBRG4 | insertion | In_Frame_Ins | novel | c.1570_1571insGTC | p.Ala524delinsGlyPro | p.A524delinsGP | Q969Z0 | protein_coding | | | TCGA-B6-A0IN-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
TBRG4 | insertion | Nonsense_Mutation | novel | c.1568_1569insGGCTTCCTGATAGTGGACGTGAGTACCTCTTGGGCAGG | p.Asp523GlufsTer4 | p.D523Efs*4 | Q969Z0 | protein_coding | | | TCGA-B6-A0IN-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
TBRG4 | deletion | In_Frame_Del | | c.606_659delGCTGCTGGCTGAGCTGCTCACACACCTGGAAAGGCGTTGGACAGAAATTGAAGA | p.Glu202_Glu219del | p.E202_E219del | Q969Z0 | protein_coding | | | TCGA-E2-A1LH-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | SD |
TBRG4 | SNV | Missense_Mutation | novel | c.337G>C | p.Glu113Gln | p.E113Q | Q969Z0 | protein_coding | tolerated(0.16) | benign(0.08) | TCGA-HM-A4S6-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | CR |
TBRG4 | SNV | Missense_Mutation | | c.776N>A | p.Arg259Gln | p.R259Q | Q969Z0 | protein_coding | tolerated(0.05) | probably_damaging(0.974) | TCGA-A6-3809-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |