|
|||||
|
 | |
| |
| |
| |
| |
| |
|
Gene: SNRPF |
Gene summary for SNRPF |
 Gene summary. |
| Gene information | Species | Human | Gene symbol | SNRPF | Gene ID | 6636 |
| Gene name | small nuclear ribonucleoprotein polypeptide F | |
| Gene Alias | SMF | |
| Cytomap | 12q23.1 | |
| Gene Type | protein-coding | GO ID | GO:0000375 | UniProtAcc | P62306 |
Top |
Malignant transformation analysis |
| Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
| Malignant transformation involving gene list. |
| Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
| 6636 | SNRPF | GSM4909282 | Human | Breast | IDC | 3.09e-04 | 3.45e-01 | -0.0288 |
| 6636 | SNRPF | GSM4909285 | Human | Breast | IDC | 2.74e-16 | 4.99e-01 | 0.21 |
| 6636 | SNRPF | GSM4909286 | Human | Breast | IDC | 2.29e-06 | 3.97e-01 | 0.1081 |
| 6636 | SNRPF | GSM4909288 | Human | Breast | IDC | 1.28e-02 | 1.49e-01 | 0.0988 |
| 6636 | SNRPF | GSM4909290 | Human | Breast | IDC | 8.41e-04 | 4.14e-01 | 0.2096 |
| 6636 | SNRPF | GSM4909293 | Human | Breast | IDC | 1.06e-04 | 3.36e-01 | 0.1581 |
| 6636 | SNRPF | GSM4909294 | Human | Breast | IDC | 6.19e-29 | 5.52e-01 | 0.2022 |
| 6636 | SNRPF | GSM4909296 | Human | Breast | IDC | 7.11e-21 | 2.55e-01 | 0.1524 |
| 6636 | SNRPF | GSM4909297 | Human | Breast | IDC | 2.15e-23 | -3.52e-02 | 0.1517 |
| 6636 | SNRPF | GSM4909301 | Human | Breast | IDC | 7.23e-05 | 2.73e-01 | 0.1577 |
| 6636 | SNRPF | GSM4909304 | Human | Breast | IDC | 1.08e-05 | 2.75e-01 | 0.1636 |
| 6636 | SNRPF | GSM4909309 | Human | Breast | IDC | 1.42e-06 | 1.50e-01 | 0.0483 |
| 6636 | SNRPF | GSM4909311 | Human | Breast | IDC | 4.71e-38 | -3.01e-01 | 0.1534 |
| 6636 | SNRPF | GSM4909312 | Human | Breast | IDC | 4.74e-14 | -1.61e-01 | 0.1552 |
| 6636 | SNRPF | GSM4909313 | Human | Breast | IDC | 1.18e-05 | -1.93e-01 | 0.0391 |
| 6636 | SNRPF | GSM4909315 | Human | Breast | IDC | 8.95e-23 | 5.84e-01 | 0.21 |
| 6636 | SNRPF | GSM4909316 | Human | Breast | IDC | 3.04e-11 | 5.03e-01 | 0.21 |
| 6636 | SNRPF | GSM4909318 | Human | Breast | IDC | 1.67e-02 | 3.99e-01 | 0.2031 |
| 6636 | SNRPF | GSM4909319 | Human | Breast | IDC | 8.99e-48 | -3.46e-01 | 0.1563 |
| 6636 | SNRPF | GSM4909320 | Human | Breast | IDC | 8.73e-06 | -2.27e-01 | 0.1575 |
| Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 |
| Transcriptomic changes along malignancy continuum. |
| Tissue | Expression Dynamics | Abbreviation |
| Breast |  | IDC: Invasive ductal carcinoma |
| DCIS: Ductal carcinoma in situ | ||
| Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers | ||
| Cervix |  | CC: Cervix cancer |
| HSIL_HPV: HPV-infected high-grade squamous intraepithelial lesions | ||
| N_HPV: HPV-infected normal cervix | ||
| Colorectum (GSE201348) |  | FAP: Familial adenomatous polyposis |
| CRC: Colorectal cancer | ||
| Colorectum (HTA11) |  | AD: Adenomas |
| SER: Sessile serrated lesions | ||
| MSI-H: Microsatellite-high colorectal cancer | ||
| MSS: Microsatellite stable colorectal cancer | ||
| Endometrium |  | AEH: Atypical endometrial hyperplasia |
| EEC: Endometrioid Cancer | ||
| Esophagus |  | ESCC: Esophageal squamous cell carcinoma |
| HGIN: High-grade intraepithelial neoplasias | ||
| LGIN: Low-grade intraepithelial neoplasias | ||
| GC |  | CAG: Chronic atrophic gastritis |
| CAG with IM: Chronic atrophic gastritis with intestinal metaplasia | ||
| CSG: Chronic superficial gastritis | ||
| GC: Gastric cancer | ||
| SIM: Severe intestinal metaplasia | ||
| WIM: Wild intestinal metaplasia | ||
| Liver |  | HCC: Hepatocellular carcinoma |
| NAFLD: Non-alcoholic fatty liver disease | ||
| Oral Cavity |  | EOLP: Erosive Oral lichen planus |
| LP: leukoplakia | ||
| NEOLP: Non-erosive oral lichen planus | ||
| OSCC: Oral squamous cell carcinoma | ||
| Prostate |  | BPH: Benign Prostatic Hyperplasia |
| Skin |  | AK: Actinic keratosis |
| cSCC: Cutaneous squamous cell carcinoma | ||
| SCCIS:squamous cell carcinoma in situ | ||
| Thyroid |  | ATC: Anaplastic thyroid cancer |
| HT: Hashimoto's thyroiditis | ||
| PTC: Papillary thyroid cancer |
| ∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
| Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
| Figure of enriched GO biological processes. |
| Tissue | Disease Stage | Enriched GO biological Processes |
| Colorectum | AD |  |
| Colorectum | SER |  |
| Colorectum | MSS |  |
| Colorectum | MSI-H |  |
| Colorectum | FAP |  |
| ∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched GO biological processes. |
| GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
| GO:00718261 | Colorectum | SER | ribonucleoprotein complex subunit organization | 70/2897 | 227/18723 | 3.83e-09 | 3.51e-07 | 70 |
| GO:00003751 | Colorectum | SER | RNA splicing, via transesterification reactions | 90/2897 | 324/18723 | 8.68e-09 | 7.50e-07 | 90 |
| GO:00003771 | Colorectum | SER | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 89/2897 | 320/18723 | 9.82e-09 | 8.14e-07 | 89 |
| GO:00003981 | Colorectum | SER | mRNA splicing, via spliceosome | 89/2897 | 320/18723 | 9.82e-09 | 8.14e-07 | 89 |
| GO:00226131 | Colorectum | SER | ribonucleoprotein complex biogenesis | 112/2897 | 463/18723 | 5.01e-07 | 2.48e-05 | 112 |
| GO:00083802 | Colorectum | MSS | RNA splicing | 159/3467 | 434/18723 | 1.75e-19 | 1.22e-16 | 159 |
| GO:00003772 | Colorectum | MSS | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 121/3467 | 320/18723 | 2.52e-16 | 8.27e-14 | 121 |
| GO:00003982 | Colorectum | MSS | mRNA splicing, via spliceosome | 121/3467 | 320/18723 | 2.52e-16 | 8.27e-14 | 121 |
| GO:00003752 | Colorectum | MSS | RNA splicing, via transesterification reactions | 122/3467 | 324/18723 | 2.75e-16 | 8.58e-14 | 122 |
| GO:00718262 | Colorectum | MSS | ribonucleoprotein complex subunit organization | 90/3467 | 227/18723 | 6.88e-14 | 1.78e-11 | 90 |
| GO:00226182 | Colorectum | MSS | ribonucleoprotein complex assembly | 88/3467 | 220/18723 | 7.12e-14 | 1.78e-11 | 88 |
| GO:00226132 | Colorectum | MSS | ribonucleoprotein complex biogenesis | 144/3467 | 463/18723 | 2.76e-11 | 3.67e-09 | 144 |
| GO:0000387 | Colorectum | MSS | spliceosomal snRNP assembly | 17/3467 | 50/18723 | 6.64e-03 | 4.38e-02 | 17 |
| GO:00226183 | Colorectum | MSI-H | ribonucleoprotein complex assembly | 62/1319 | 220/18723 | 7.13e-22 | 8.32e-19 | 62 |
| GO:00718263 | Colorectum | MSI-H | ribonucleoprotein complex subunit organization | 63/1319 | 227/18723 | 8.08e-22 | 8.32e-19 | 63 |
| GO:00226133 | Colorectum | MSI-H | ribonucleoprotein complex biogenesis | 95/1319 | 463/18723 | 1.04e-21 | 8.32e-19 | 95 |
| GO:00083803 | Colorectum | MSI-H | RNA splicing | 82/1319 | 434/18723 | 1.22e-16 | 4.53e-14 | 82 |
| GO:00003753 | Colorectum | MSI-H | RNA splicing, via transesterification reactions | 67/1319 | 324/18723 | 7.99e-16 | 2.61e-13 | 67 |
| GO:00003773 | Colorectum | MSI-H | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 66/1319 | 320/18723 | 1.51e-15 | 4.41e-13 | 66 |
| GO:00003983 | Colorectum | MSI-H | mRNA splicing, via spliceosome | 66/1319 | 320/18723 | 1.51e-15 | 4.41e-13 | 66 |
| Page: 1 2 3 4 5 6 7 8 9 10 11 |
| Enriched KEGG pathways. |
| Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
| hsa030408 | Breast | Precancer | Spliceosome | 39/684 | 217/8465 | 1.44e-06 | 2.27e-05 | 1.74e-05 | 39 |
| hsa0304013 | Breast | Precancer | Spliceosome | 39/684 | 217/8465 | 1.44e-06 | 2.27e-05 | 1.74e-05 | 39 |
| hsa0304023 | Breast | IDC | Spliceosome | 40/867 | 217/8465 | 1.53e-04 | 1.42e-03 | 1.06e-03 | 40 |
| hsa0304033 | Breast | IDC | Spliceosome | 40/867 | 217/8465 | 1.53e-04 | 1.42e-03 | 1.06e-03 | 40 |
| hsa0304043 | Breast | DCIS | Spliceosome | 40/846 | 217/8465 | 8.97e-05 | 8.52e-04 | 6.28e-04 | 40 |
| hsa0304053 | Breast | DCIS | Spliceosome | 40/846 | 217/8465 | 8.97e-05 | 8.52e-04 | 6.28e-04 | 40 |
| hsa03040 | Colorectum | AD | Spliceosome | 73/2092 | 217/8465 | 1.73e-03 | 9.68e-03 | 6.18e-03 | 73 |
| hsa030401 | Colorectum | AD | Spliceosome | 73/2092 | 217/8465 | 1.73e-03 | 9.68e-03 | 6.18e-03 | 73 |
| hsa030402 | Colorectum | MSS | Spliceosome | 66/1875 | 217/8465 | 2.58e-03 | 1.27e-02 | 7.81e-03 | 66 |
| hsa030403 | Colorectum | MSS | Spliceosome | 66/1875 | 217/8465 | 2.58e-03 | 1.27e-02 | 7.81e-03 | 66 |
| hsa030404 | Colorectum | MSI-H | Spliceosome | 37/797 | 217/8465 | 2.49e-04 | 3.23e-03 | 2.70e-03 | 37 |
| hsa030405 | Colorectum | MSI-H | Spliceosome | 37/797 | 217/8465 | 2.49e-04 | 3.23e-03 | 2.70e-03 | 37 |
| hsa030409 | Endometrium | AEH | Spliceosome | 54/1197 | 217/8465 | 1.47e-05 | 1.65e-04 | 1.21e-04 | 54 |
| hsa0304014 | Endometrium | AEH | Spliceosome | 54/1197 | 217/8465 | 1.47e-05 | 1.65e-04 | 1.21e-04 | 54 |
| hsa0304024 | Endometrium | EEC | Spliceosome | 54/1237 | 217/8465 | 3.78e-05 | 3.88e-04 | 2.89e-04 | 54 |
| hsa0304034 | Endometrium | EEC | Spliceosome | 54/1237 | 217/8465 | 3.78e-05 | 3.88e-04 | 2.89e-04 | 54 |
| hsa0304027 | Esophagus | ESCC | Spliceosome | 128/4205 | 217/8465 | 3.31e-03 | 8.79e-03 | 4.50e-03 | 128 |
| hsa0304037 | Esophagus | ESCC | Spliceosome | 128/4205 | 217/8465 | 3.31e-03 | 8.79e-03 | 4.50e-03 | 128 |
| hsa030407 | Liver | Cirrhotic | Spliceosome | 102/2530 | 217/8465 | 5.69e-08 | 9.47e-07 | 5.84e-07 | 102 |
| hsa0304012 | Liver | Cirrhotic | Spliceosome | 102/2530 | 217/8465 | 5.69e-08 | 9.47e-07 | 5.84e-07 | 102 |
| Page: 1 2 |
Top |
Cell-cell communication analysis |
| Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
| Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
| Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
| Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
| TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
| ∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
| Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
| Annotation of somatic variants for genes involved in malignant transformation |
| Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
| SNRPF | SNV | Missense_Mutation | novel | c.52N>T | p.Pro18Ser | p.P18S | P62306 | protein_coding | tolerated(0.17) | benign(0.021) | TCGA-AP-A1DK-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
| SNRPF | SNV | Missense_Mutation | novel | c.119T>C | p.Met40Thr | p.M40T | P62306 | protein_coding | deleterious(0) | probably_damaging(0.978) | TCGA-EO-A22R-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
| SNRPF | deletion | In_Frame_Del | novel | c.62_82delTGAAACTTAAGTGGGGAATGG | p.Val21_Met27del | p.V21_M27del | P62306 | protein_coding | TCGA-CC-A7IJ-01 | Liver | liver hepatocellular carcinoma | Male | <65 | I/II | Unknown | Unknown | SD | ||
| SNRPF | SNV | Missense_Mutation | c.169N>A | p.Gly57Arg | p.G57R | P62306 | protein_coding | deleterious(0.01) | possibly_damaging(0.77) | TCGA-33-6737-01 | Lung | lung squamous cell carcinoma | Male | >=65 | III/IV | Chemotherapy | gemcitabine | PD |
| Page: 1 |
Top |
Related drugs of malignant transformation related genes |
| Identification of chemicals and drugs interact with genes involved in malignant transfromation |
| (DGIdb 4.0) |
| Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
| Page: 1 |
Copyright 2023-Present -The University of Texas Health Science Center at Houston |