![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: HPN |
Gene summary for HPN |
![]() |
Gene information | Species | Human | Gene symbol | HPN | Gene ID | 3249 |
Gene name | hepsin | |
Gene Alias | TMPRSS1 | |
Cytomap | 19q13.11 | |
Gene Type | protein-coding | GO ID | GO:0000902 | UniProtAcc | A0A140VJK9 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
3249 | HPN | NAFLD1 | Human | Liver | NAFLD | 3.97e-16 | 1.41e+00 | -0.04 |
3249 | HPN | S43 | Human | Liver | Cirrhotic | 1.63e-13 | -2.72e-01 | -0.0187 |
3249 | HPN | HCC1_Meng | Human | Liver | HCC | 2.76e-76 | -4.64e-02 | 0.0246 |
3249 | HPN | HCC2_Meng | Human | Liver | HCC | 1.48e-14 | -3.86e-01 | 0.0107 |
3249 | HPN | cirrhotic1 | Human | Liver | Cirrhotic | 1.03e-07 | -2.23e-01 | 0.0202 |
3249 | HPN | cirrhotic2 | Human | Liver | Cirrhotic | 1.02e-06 | -1.54e-01 | 0.0201 |
3249 | HPN | cirrhotic3 | Human | Liver | Cirrhotic | 6.16e-03 | -2.40e-01 | 0.0215 |
3249 | HPN | HCC2 | Human | Liver | HCC | 1.51e-15 | 3.60e+00 | 0.5341 |
3249 | HPN | Pt13.a | Human | Liver | HCC | 2.93e-02 | -1.33e-01 | 0.021 |
3249 | HPN | Pt13.b | Human | Liver | HCC | 7.69e-27 | 1.98e-02 | 0.0251 |
3249 | HPN | Pt14.a | Human | Liver | HCC | 6.99e-05 | 1.28e-01 | 0.0169 |
3249 | HPN | Pt14.b | Human | Liver | HCC | 5.71e-07 | 7.69e-02 | 0.018 |
3249 | HPN | S027 | Human | Liver | HCC | 4.27e-20 | 1.90e+00 | 0.2446 |
3249 | HPN | S028 | Human | Liver | HCC | 1.10e-38 | 1.98e+00 | 0.2503 |
3249 | HPN | S029 | Human | Liver | HCC | 3.43e-40 | 2.54e+00 | 0.2581 |
3249 | HPN | male-WTA | Human | Thyroid | PTC | 5.31e-35 | 4.60e-01 | 0.1037 |
3249 | HPN | PTC01 | Human | Thyroid | PTC | 7.69e-26 | 4.86e-01 | 0.1899 |
3249 | HPN | PTC03 | Human | Thyroid | PTC | 5.36e-04 | 3.63e-01 | 0.1784 |
3249 | HPN | PTC04 | Human | Thyroid | PTC | 3.27e-07 | 2.05e-01 | 0.1927 |
3249 | HPN | PTC05 | Human | Thyroid | PTC | 1.42e-26 | 9.08e-01 | 0.2065 |
Page: 1 2 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00329701 | Colorectum | SER | regulation of actin filament-based process | 115/2897 | 397/18723 | 4.16e-12 | 8.80e-10 | 115 |
GO:00329561 | Colorectum | SER | regulation of actin cytoskeleton organization | 104/2897 | 358/18723 | 3.68e-11 | 6.11e-09 | 104 |
GO:00106391 | Colorectum | SER | negative regulation of organelle organization | 90/2897 | 348/18723 | 3.14e-07 | 1.69e-05 | 90 |
GO:19029041 | Colorectum | SER | negative regulation of supramolecular fiber organization | 50/2897 | 167/18723 | 1.63e-06 | 7.23e-05 | 50 |
GO:00615721 | Colorectum | SER | actin filament bundle organization | 48/2897 | 161/18723 | 2.97e-06 | 1.19e-04 | 48 |
GO:00514941 | Colorectum | SER | negative regulation of cytoskeleton organization | 48/2897 | 163/18723 | 4.34e-06 | 1.63e-04 | 48 |
GO:00510171 | Colorectum | SER | actin filament bundle assembly | 46/2897 | 157/18723 | 7.88e-06 | 2.69e-04 | 46 |
GO:00322311 | Colorectum | SER | regulation of actin filament bundle assembly | 29/2897 | 105/18723 | 1.01e-03 | 1.20e-02 | 29 |
GO:00030141 | Colorectum | SER | renal system process | 30/2897 | 110/18723 | 1.05e-03 | 1.22e-02 | 30 |
GO:00300381 | Colorectum | SER | contractile actin filament bundle assembly | 29/2897 | 106/18723 | 1.19e-03 | 1.36e-02 | 29 |
GO:00431491 | Colorectum | SER | stress fiber assembly | 29/2897 | 106/18723 | 1.19e-03 | 1.36e-02 | 29 |
GO:00514921 | Colorectum | SER | regulation of stress fiber assembly | 25/2897 | 91/18723 | 2.36e-03 | 2.25e-02 | 25 |
GO:00310321 | Colorectum | SER | actomyosin structure organization | 45/2897 | 196/18723 | 3.60e-03 | 3.03e-02 | 45 |
GO:01100201 | Colorectum | SER | regulation of actomyosin structure organization | 26/2897 | 100/18723 | 4.43e-03 | 3.54e-02 | 26 |
GO:00070152 | Colorectum | MSS | actin filament organization | 146/3467 | 442/18723 | 1.16e-13 | 2.67e-11 | 146 |
GO:00329702 | Colorectum | MSS | regulation of actin filament-based process | 128/3467 | 397/18723 | 2.47e-11 | 3.49e-09 | 128 |
GO:19029032 | Colorectum | MSS | regulation of supramolecular fiber organization | 121/3467 | 383/18723 | 3.63e-10 | 3.28e-08 | 121 |
GO:00329562 | Colorectum | MSS | regulation of actin cytoskeleton organization | 113/3467 | 358/18723 | 1.46e-09 | 1.07e-07 | 113 |
GO:01100532 | Colorectum | MSS | regulation of actin filament organization | 92/3467 | 278/18723 | 3.61e-09 | 2.42e-07 | 92 |
GO:00106392 | Colorectum | MSS | negative regulation of organelle organization | 102/3467 | 348/18723 | 5.36e-07 | 2.05e-05 | 102 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa05203 | Liver | Cirrhotic | Viral carcinogenesis | 76/2530 | 204/8465 | 1.34e-02 | 4.20e-02 | 2.59e-02 | 76 |
hsa052031 | Liver | Cirrhotic | Viral carcinogenesis | 76/2530 | 204/8465 | 1.34e-02 | 4.20e-02 | 2.59e-02 | 76 |
hsa052032 | Liver | HCC | Viral carcinogenesis | 117/4020 | 204/8465 | 2.68e-03 | 8.98e-03 | 5.00e-03 | 117 |
hsa052033 | Liver | HCC | Viral carcinogenesis | 117/4020 | 204/8465 | 2.68e-03 | 8.98e-03 | 5.00e-03 | 117 |
hsa0520323 | Prostate | Tumor | Viral carcinogenesis | 70/1791 | 204/8465 | 7.53e-06 | 6.56e-05 | 4.07e-05 | 70 |
hsa0520333 | Prostate | Tumor | Viral carcinogenesis | 70/1791 | 204/8465 | 7.53e-06 | 6.56e-05 | 4.07e-05 | 70 |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
HPN | SNV | Missense_Mutation | novel | c.1232N>A | p.Ser411Asn | p.S411N | P05981 | protein_coding | tolerated(0.22) | benign(0) | TCGA-AN-A0AK-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
HPN | SNV | Missense_Mutation | c.721N>T | p.Gly241Trp | p.G241W | P05981 | protein_coding | deleterious(0) | probably_damaging(0.992) | TCGA-EW-A6S9-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |
HPN | SNV | Missense_Mutation | rs751620154 | c.484N>T | p.Arg162Cys | p.R162C | P05981 | protein_coding | deleterious(0) | probably_damaging(0.961) | TCGA-PE-A5DD-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | CR | |
HPN | SNV | Missense_Mutation | novel | c.281G>T | p.Gly94Val | p.G94V | P05981 | protein_coding | deleterious(0) | probably_damaging(1) | TCGA-S3-AA10-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | cytoxan | CR |
HPN | insertion | Frame_Shift_Ins | novel | c.105_118+8dupATCCTGGGCCATTGGTGAGAGC | P05981 | protein_coding | TCGA-B6-A0I6-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD | ||||
HPN | SNV | Missense_Mutation | novel | c.407N>T | p.Ser136Phe | p.S136F | P05981 | protein_coding | tolerated(0.68) | benign(0.007) | TCGA-2W-A8YY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
HPN | SNV | Missense_Mutation | rs753366151 | c.1223N>T | p.Ser408Phe | p.S408F | P05981 | protein_coding | deleterious(0.02) | possibly_damaging(0.806) | TCGA-EK-A3GM-01 | Cervix | cervical & endocervical cancer | Female | >=65 | I/II | Unknown | Unknown | SD |
HPN | SNV | Missense_Mutation | c.341C>T | p.Thr114Met | p.T114M | P05981 | protein_coding | deleterious(0.01) | probably_damaging(0.979) | TCGA-AA-3489-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | PD | |
HPN | SNV | Missense_Mutation | rs374894952 | c.641N>A | p.Arg214Gln | p.R214Q | P05981 | protein_coding | tolerated(0.07) | benign(0.089) | TCGA-CA-6718-01 | Colorectum | colon adenocarcinoma | Male | <65 | I/II | Unknown | Unknown | PD |
HPN | SNV | Missense_Mutation | c.112G>C | p.Ala38Pro | p.A38P | P05981 | protein_coding | deleterious(0.01) | possibly_damaging(0.694) | TCGA-CM-6171-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
3249 | HPN | DRUGGABLE GENOME, PROTEASE, CELL SURFACE | BENTIROMIDE | BENTIROMIDE | ||
3249 | HPN | DRUGGABLE GENOME, PROTEASE, CELL SURFACE | AC1LFXA6 | |||
3249 | HPN | DRUGGABLE GENOME, PROTEASE, CELL SURFACE | N-Methyl-D-aspartic acid | |||
3249 | HPN | DRUGGABLE GENOME, PROTEASE, CELL SURFACE | Meclizine | MECLIZINE | ||
3249 | HPN | DRUGGABLE GENOME, PROTEASE, CELL SURFACE | BENTIROMIDE | BENTIROMIDE |
Page: 1 |