|
|||||
|
 | |
| |
| |
| |
| |
| |
|
Gene: DLGAP5 |
Gene summary for DLGAP5 |
 Gene summary. |
| Gene information | Species | Human | Gene symbol | DLGAP5 | Gene ID | 9787 |
| Gene name | DLG associated protein 5 | |
| Gene Alias | DLG7 | |
| Cytomap | 14q22.3 | |
| Gene Type | protein-coding | GO ID | GO:0000070 | UniProtAcc | Q15398 |
Top |
Malignant transformation analysis |
| Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
| Malignant transformation involving gene list. |
| Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
| 9787 | DLGAP5 | P2T-E | Human | Esophagus | ESCC | 4.17e-05 | 2.95e-01 | 0.1177 |
| 9787 | DLGAP5 | P4T-E | Human | Esophagus | ESCC | 3.48e-08 | 3.22e-01 | 0.1323 |
| 9787 | DLGAP5 | P5T-E | Human | Esophagus | ESCC | 4.41e-07 | 1.91e-01 | 0.1327 |
| 9787 | DLGAP5 | P9T-E | Human | Esophagus | ESCC | 1.11e-03 | 1.56e-01 | 0.1131 |
| 9787 | DLGAP5 | P10T-E | Human | Esophagus | ESCC | 8.84e-05 | 2.60e-01 | 0.116 |
| 9787 | DLGAP5 | P15T-E | Human | Esophagus | ESCC | 3.38e-04 | 3.10e-01 | 0.1149 |
| 9787 | DLGAP5 | P17T-E | Human | Esophagus | ESCC | 8.50e-05 | 4.01e-01 | 0.1278 |
| 9787 | DLGAP5 | P19T-E | Human | Esophagus | ESCC | 5.57e-05 | 5.72e-01 | 0.1662 |
| 9787 | DLGAP5 | P20T-E | Human | Esophagus | ESCC | 1.51e-02 | 1.78e-01 | 0.1124 |
| 9787 | DLGAP5 | P21T-E | Human | Esophagus | ESCC | 4.31e-06 | 2.54e-01 | 0.1617 |
| 9787 | DLGAP5 | P24T-E | Human | Esophagus | ESCC | 3.60e-13 | 4.44e-01 | 0.1287 |
| 9787 | DLGAP5 | P26T-E | Human | Esophagus | ESCC | 1.88e-04 | 2.85e-01 | 0.1276 |
| 9787 | DLGAP5 | P28T-E | Human | Esophagus | ESCC | 3.50e-02 | 9.61e-02 | 0.1149 |
| 9787 | DLGAP5 | P30T-E | Human | Esophagus | ESCC | 1.02e-02 | 3.43e-01 | 0.137 |
| 9787 | DLGAP5 | P31T-E | Human | Esophagus | ESCC | 1.96e-05 | 2.52e-01 | 0.1251 |
| 9787 | DLGAP5 | P32T-E | Human | Esophagus | ESCC | 4.12e-11 | 2.93e-01 | 0.1666 |
| 9787 | DLGAP5 | P36T-E | Human | Esophagus | ESCC | 2.11e-03 | 2.27e-01 | 0.1187 |
| 9787 | DLGAP5 | P37T-E | Human | Esophagus | ESCC | 4.26e-12 | 5.49e-01 | 0.1371 |
| 9787 | DLGAP5 | P38T-E | Human | Esophagus | ESCC | 1.30e-06 | 4.85e-01 | 0.127 |
| 9787 | DLGAP5 | P42T-E | Human | Esophagus | ESCC | 2.93e-03 | 2.26e-01 | 0.1175 |
| Page: 1 2 3 |
| Transcriptomic changes along malignancy continuum. |
| Tissue | Expression Dynamics | Abbreviation |
| Esophagus |  | ESCC: Esophageal squamous cell carcinoma |
| HGIN: High-grade intraepithelial neoplasias | ||
| LGIN: Low-grade intraepithelial neoplasias | ||
| Oral Cavity |  | EOLP: Erosive Oral lichen planus |
| LP: leukoplakia | ||
| NEOLP: Non-erosive oral lichen planus | ||
| OSCC: Oral squamous cell carcinoma | ||
| Skin |  | AK: Actinic keratosis |
| cSCC: Cutaneous squamous cell carcinoma | ||
| SCCIS:squamous cell carcinoma in situ | ||
| Thyroid |  | ATC: Anaplastic thyroid cancer |
| HT: Hashimoto's thyroiditis | ||
| PTC: Papillary thyroid cancer |
| ∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
| Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
| Figure of enriched GO biological processes. |
| Tissue | Disease Stage | Enriched GO biological Processes |
| Colorectum | AD |  |
| Colorectum | SER |  |
| Colorectum | MSS |  |
| Colorectum | MSI-H |  |
| Colorectum | FAP |  |
| ∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched GO biological processes. |
| GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
| GO:00070883 | Esophagus | ESCC | regulation of mitotic nuclear division | 78/8552 | 110/18723 | 6.96e-08 | 1.21e-06 | 78 |
| GO:00070912 | Esophagus | ESCC | metaphase/anaphase transition of mitotic cell cycle | 49/8552 | 62/18723 | 7.65e-08 | 1.33e-06 | 49 |
| GO:00513062 | Esophagus | ESCC | mitotic sister chromatid separation | 52/8552 | 67/18723 | 9.14e-08 | 1.52e-06 | 52 |
| GO:00330452 | Esophagus | ESCC | regulation of sister chromatid segregation | 55/8552 | 72/18723 | 1.03e-07 | 1.69e-06 | 55 |
| GO:00300712 | Esophagus | ESCC | regulation of mitotic metaphase/anaphase transition | 47/8552 | 60/18723 | 2.32e-07 | 3.53e-06 | 47 |
| GO:00109652 | Esophagus | ESCC | regulation of mitotic sister chromatid separation | 50/8552 | 65/18723 | 2.67e-07 | 3.97e-06 | 50 |
| GO:00447842 | Esophagus | ESCC | metaphase/anaphase transition of cell cycle | 50/8552 | 65/18723 | 2.67e-07 | 3.97e-06 | 50 |
| GO:004593116 | Esophagus | ESCC | positive regulation of mitotic cell cycle | 83/8552 | 121/18723 | 2.78e-07 | 4.08e-06 | 83 |
| GO:19058182 | Esophagus | ESCC | regulation of chromosome separation | 54/8552 | 72/18723 | 3.85e-07 | 5.32e-06 | 54 |
| GO:19020992 | Esophagus | ESCC | regulation of metaphase/anaphase transition of cell cycle | 48/8552 | 63/18723 | 7.67e-07 | 9.95e-06 | 48 |
| GO:19019896 | Esophagus | ESCC | positive regulation of cell cycle phase transition | 77/8552 | 115/18723 | 3.20e-06 | 3.58e-05 | 77 |
| GO:00618428 | Esophagus | ESCC | microtubule organizing center localization | 28/8552 | 33/18723 | 3.80e-06 | 4.12e-05 | 28 |
| GO:00517831 | Esophagus | ESCC | regulation of nuclear division | 90/8552 | 139/18723 | 4.30e-06 | 4.60e-05 | 90 |
| GO:00900689 | Esophagus | ESCC | positive regulation of cell cycle process | 142/8552 | 236/18723 | 4.79e-06 | 5.08e-05 | 142 |
| GO:00513831 | Esophagus | ESCC | kinetochore organization | 21/8552 | 23/18723 | 5.69e-06 | 5.90e-05 | 21 |
| GO:00516428 | Esophagus | ESCC | centrosome localization | 27/8552 | 32/18723 | 7.10e-06 | 7.12e-05 | 27 |
| GO:00345081 | Esophagus | ESCC | centromere complex assembly | 25/8552 | 30/18723 | 2.45e-05 | 2.09e-04 | 25 |
| GO:00513042 | Esophagus | ESCC | chromosome separation | 64/8552 | 96/18723 | 2.61e-05 | 2.20e-04 | 64 |
| GO:19019925 | Esophagus | ESCC | positive regulation of mitotic cell cycle phase transition | 62/8552 | 93/18723 | 3.47e-05 | 2.83e-04 | 62 |
| GO:00513821 | Esophagus | ESCC | kinetochore assembly | 16/8552 | 18/18723 | 1.78e-04 | 1.15e-03 | 16 |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched KEGG pathways. |
| Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
| Page: 1 |
Top |
Cell-cell communication analysis |
| Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
| Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
| Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
| Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
| TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
| ∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
| Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
| Annotation of somatic variants for genes involved in malignant transformation |
| Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
| DLGAP5 | SNV | Missense_Mutation | novel | c.1922N>C | p.Lys641Thr | p.K641T | Q15398 | protein_coding | tolerated(0.2) | benign(0.003) | TCGA-AN-A046-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
| DLGAP5 | SNV | Missense_Mutation | c.992N>A | p.Arg331Lys | p.R331K | Q15398 | protein_coding | tolerated(0.07) | benign(0.151) | TCGA-D8-A1JA-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | adriamycin | PD | |
| DLGAP5 | SNV | Missense_Mutation | c.1978N>G | p.Thr660Ala | p.T660A | Q15398 | protein_coding | tolerated(0.61) | benign(0.007) | TCGA-E2-A1LL-01 | Breast | breast invasive carcinoma | Female | >=65 | III/IV | Chemotherapy | docetaxel | PD | |
| DLGAP5 | deletion | Frame_Shift_Del | c.124_160delAATAGACACTTTGGTTTGAAAGATGTAAACATTCCAA | p.Asn42ProfsTer10 | p.N42Pfs*10 | Q15398 | protein_coding | TCGA-A1-A0SO-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | SD | ||||
| DLGAP5 | deletion | Frame_Shift_Del | novel | c.1773delN | p.Glu591AspfsTer9 | p.E591Dfs*9 | Q15398 | protein_coding | TCGA-EW-A2FV-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | docetaxel | SD | ||
| DLGAP5 | deletion | Frame_Shift_Del | novel | c.1519delN | p.Asp507MetfsTer11 | p.D507Mfs*11 | Q15398 | protein_coding | TCGA-EW-A2FV-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | docetaxel | SD | ||
| DLGAP5 | SNV | Missense_Mutation | c.326N>G | p.Gln109Arg | p.Q109R | Q15398 | protein_coding | deleterious(0) | probably_damaging(0.909) | TCGA-C5-A3HL-01 | Cervix | cervical & endocervical cancer | Female | >=65 | I/II | Unknown | Unknown | SD | |
| DLGAP5 | SNV | Missense_Mutation | c.1045N>A | p.Glu349Lys | p.E349K | Q15398 | protein_coding | tolerated(0.1) | benign(0.173) | TCGA-LP-A4AV-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD | |
| DLGAP5 | SNV | Missense_Mutation | novel | c.673N>T | p.Ala225Ser | p.A225S | Q15398 | protein_coding | tolerated(0.28) | benign(0.003) | TCGA-MA-AA3W-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
| DLGAP5 | SNV | Missense_Mutation | novel | c.322G>C | p.Glu108Gln | p.E108Q | Q15398 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-VS-A9UZ-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD |
| Page: 1 2 3 4 5 6 7 8 |
Top |
Related drugs of malignant transformation related genes |
| Identification of chemicals and drugs interact with genes involved in malignant transfromation |
| (DGIdb 4.0) |
| Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
| Page: 1 |
Copyright 2023-Present -The University of Texas Health Science Center at Houston |